\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101198038:

Variant ID: vg1101198038 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 1198038
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGAGCCATGAAGTTAAGCATGAAACGACCCCCGTACAACCGCACTTCTCGTATGGGTATAGACCTAGTGGAGTAGATAGCCGAGCGAGGCAGTATCCCT[G/A]
CATAGATGATTCACCCCTGAGTGAGGCAGGTGCGCTACGGTGGGACAGCCGTTGAGGTAGGGCCGAGAGGCGTGCCCTACATCGGTGTCGCCATTGGTAG

Reverse complement sequence

CTACCAATGGCGACACCGATGTAGGGCACGCCTCTCGGCCCTACCTCAACGGCTGTCCCACCGTAGCGCACCTGCCTCACTCAGGGGTGAATCATCTATG[C/T]
AGGGATACTGCCTCGCTCGGCTATCTACTCCACTAGGTCTATACCCATACGAGAAGTGCGGTTGTACGGGGGTCGTTTCATGCTTAACTTCATGGCTCGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.00% 4.90% 13.29% 45.83% NA
All Indica  2759 8.40% 0.30% 19.46% 71.84% NA
All Japonica  1512 83.30% 14.40% 0.33% 1.92% NA
Aus  269 31.60% 0.00% 24.91% 43.49% NA
Indica I  595 4.90% 0.00% 12.94% 82.18% NA
Indica II  465 16.60% 0.60% 11.83% 70.97% NA
Indica III  913 4.20% 0.00% 28.04% 67.80% NA
Indica Intermediate  786 11.20% 0.60% 18.96% 69.21% NA
Temperate Japonica  767 92.00% 5.90% 0.39% 1.69% NA
Tropical Japonica  504 71.20% 26.60% 0.20% 1.98% NA
Japonica Intermediate  241 80.90% 16.20% 0.41% 2.49% NA
VI/Aromatic  96 81.20% 0.00% 8.33% 10.42% NA
Intermediate  90 48.90% 7.80% 12.22% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1101198038 G -> A LOC_Os11g03260.1 upstream_gene_variant ; 207.0bp to feature; MODIFIER silent_mutation Average:22.263; most accessible tissue: Minghui63 flag leaf, score: 45.195 N N N N
vg1101198038 G -> A LOC_Os11g03270.1 upstream_gene_variant ; 4702.0bp to feature; MODIFIER silent_mutation Average:22.263; most accessible tissue: Minghui63 flag leaf, score: 45.195 N N N N
vg1101198038 G -> A LOC_Os11g03250.1 downstream_gene_variant ; 3074.0bp to feature; MODIFIER silent_mutation Average:22.263; most accessible tissue: Minghui63 flag leaf, score: 45.195 N N N N
vg1101198038 G -> A LOC_Os11g03260-LOC_Os11g03270 intergenic_region ; MODIFIER silent_mutation Average:22.263; most accessible tissue: Minghui63 flag leaf, score: 45.195 N N N N
vg1101198038 G -> DEL N N silent_mutation Average:22.263; most accessible tissue: Minghui63 flag leaf, score: 45.195 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1101198038 3.39E-07 NA mr1204 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251