\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101195615:

Variant ID: vg1101195615 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 1195615
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTTGAGGACGGAATACCCGCATCTATTCGAAAACTGGTAAGAAATCTCGGGACGAGATTTATTTAAGGGGGGTAGGTTTGTAACACCCTGAAAATTCGA[T/C]
CGACAAAATCAAAACTCTAAAAATACGGATTTTCAAAAACCTTTTTAAATTAATTGCATCATGCCGATCTTATTCGCCTATTTTATCCGGATTTGATCTC

Reverse complement sequence

GAGATCAAATCCGGATAAAATAGGCGAATAAGATCGGCATGATGCAATTAATTTAAAAAGGTTTTTGAAAATCCGTATTTTTAGAGTTTTGATTTTGTCG[A/G]
TCGAATTTTCAGGGTGTTACAAACCTACCCCCCTTAAATAAATCTCGTCCCGAGATTTCTTACCAGTTTTCGAATAGATGCGGGTATTCCGTCCTCAAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.10% 0.10% 4.74% 55.08% NA
All Indica  2759 11.70% 0.00% 2.79% 85.50% NA
All Japonica  1512 97.30% 0.00% 0.20% 2.51% NA
Aus  269 10.80% 0.40% 25.65% 63.20% NA
Indica I  595 11.10% 0.00% 0.67% 88.24% NA
Indica II  465 18.10% 0.00% 1.51% 80.43% NA
Indica III  913 4.10% 0.00% 3.94% 92.00% NA
Indica Intermediate  786 17.20% 0.10% 3.82% 78.88% NA
Temperate Japonica  767 97.80% 0.00% 0.00% 2.22% NA
Tropical Japonica  504 97.40% 0.00% 0.20% 2.38% NA
Japonica Intermediate  241 95.40% 0.00% 0.83% 3.73% NA
VI/Aromatic  96 20.80% 4.20% 70.83% 4.17% NA
Intermediate  90 56.70% 0.00% 7.78% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1101195615 T -> DEL N N silent_mutation Average:15.409; most accessible tissue: Minghui63 flower, score: 26.71 N N N N
vg1101195615 T -> C LOC_Os11g03250.1 downstream_gene_variant ; 651.0bp to feature; MODIFIER silent_mutation Average:15.409; most accessible tissue: Minghui63 flower, score: 26.71 N N N N
vg1101195615 T -> C LOC_Os11g03260.1 downstream_gene_variant ; 683.0bp to feature; MODIFIER silent_mutation Average:15.409; most accessible tissue: Minghui63 flower, score: 26.71 N N N N
vg1101195615 T -> C LOC_Os11g03250-LOC_Os11g03260 intergenic_region ; MODIFIER silent_mutation Average:15.409; most accessible tissue: Minghui63 flower, score: 26.71 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1101195615 NA 5.22E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101195615 NA 6.23E-10 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101195615 NA 1.93E-12 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101195615 NA 2.10E-12 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101195615 4.86E-06 NA mr1996_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101195615 NA 1.73E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251