Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101195615:

Variant ID: vg1101195615 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 1195615
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTTGAGGACGGAATACCCGCATCTATTCGAAAACTGGTAAGAAATCTCGGGACGAGATTTATTTAAGGGGGGTAGGTTTGTAACACCCTGAAAATTCGA[T/C]
CGACAAAATCAAAACTCTAAAAATACGGATTTTCAAAAACCTTTTTAAATTAATTGCATCATGCCGATCTTATTCGCCTATTTTATCCGGATTTGATCTC

Reverse complement sequence

GAGATCAAATCCGGATAAAATAGGCGAATAAGATCGGCATGATGCAATTAATTTAAAAAGGTTTTTGAAAATCCGTATTTTTAGAGTTTTGATTTTGTCG[A/G]
TCGAATTTTCAGGGTGTTACAAACCTACCCCCCTTAAATAAATCTCGTCCCGAGATTTCTTACCAGTTTTCGAATAGATGCGGGTATTCCGTCCTCAAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.10%	0.10%	4.74%	55.08%	NA
All Indica	2759	11.70%	0.00%	2.79%	85.50%	NA
All Japonica	1512	97.30%	0.00%	0.20%	2.51%	NA
Aus	269	10.80%	0.40%	25.65%	63.20%	NA
Indica I	595	11.10%	0.00%	0.67%	88.24%	NA
Indica II	465	18.10%	0.00%	1.51%	80.43%	NA
Indica III	913	4.10%	0.00%	3.94%	92.00%	NA
Indica Intermediate	786	17.20%	0.10%	3.82%	78.88%	NA
Temperate Japonica	767	97.80%	0.00%	0.00%	2.22%	NA
Tropical Japonica	504	97.40%	0.00%	0.20%	2.38%	NA
Japonica Intermediate	241	95.40%	0.00%	0.83%	3.73%	NA
VI/Aromatic	96	20.80%	4.20%	70.83%	4.17%	NA
Intermediate	90	56.70%	0.00%	7.78%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1101195615	T -> DEL	N	N	silent_mutation	Average:15.409; most accessible tissue: Minghui63 flower, score: 26.71	N	N	N	N
vg1101195615	T -> C	LOC_Os11g03250.1	downstream_gene_variant ; 651.0bp to feature; MODIFIER	silent_mutation	Average:15.409; most accessible tissue: Minghui63 flower, score: 26.71	N	N	N	N
vg1101195615	T -> C	LOC_Os11g03260.1	downstream_gene_variant ; 683.0bp to feature; MODIFIER	silent_mutation	Average:15.409; most accessible tissue: Minghui63 flower, score: 26.71	N	N	N	N
vg1101195615	T -> C	LOC_Os11g03250-LOC_Os11g03260	intergenic_region ; MODIFIER	silent_mutation	Average:15.409; most accessible tissue: Minghui63 flower, score: 26.71	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1101195615	NA	5.22E-10	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101195615	NA	6.23E-10	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101195615	NA	1.93E-12	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101195615	NA	2.10E-12	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101195615	4.86E-06	NA	mr1996_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101195615	NA	1.73E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251