\
| Variant ID: vg1101195615 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 1195615 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCTTGAGGACGGAATACCCGCATCTATTCGAAAACTGGTAAGAAATCTCGGGACGAGATTTATTTAAGGGGGGTAGGTTTGTAACACCCTGAAAATTCGA[T/C]
CGACAAAATCAAAACTCTAAAAATACGGATTTTCAAAAACCTTTTTAAATTAATTGCATCATGCCGATCTTATTCGCCTATTTTATCCGGATTTGATCTC
GAGATCAAATCCGGATAAAATAGGCGAATAAGATCGGCATGATGCAATTAATTTAAAAAGGTTTTTGAAAATCCGTATTTTTAGAGTTTTGATTTTGTCG[A/G]
TCGAATTTTCAGGGTGTTACAAACCTACCCCCCTTAAATAAATCTCGTCCCGAGATTTCTTACCAGTTTTCGAATAGATGCGGGTATTCCGTCCTCAAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.10% | 0.10% | 4.74% | 55.08% | NA |
| All Indica | 2759 | 11.70% | 0.00% | 2.79% | 85.50% | NA |
| All Japonica | 1512 | 97.30% | 0.00% | 0.20% | 2.51% | NA |
| Aus | 269 | 10.80% | 0.40% | 25.65% | 63.20% | NA |
| Indica I | 595 | 11.10% | 0.00% | 0.67% | 88.24% | NA |
| Indica II | 465 | 18.10% | 0.00% | 1.51% | 80.43% | NA |
| Indica III | 913 | 4.10% | 0.00% | 3.94% | 92.00% | NA |
| Indica Intermediate | 786 | 17.20% | 0.10% | 3.82% | 78.88% | NA |
| Temperate Japonica | 767 | 97.80% | 0.00% | 0.00% | 2.22% | NA |
| Tropical Japonica | 504 | 97.40% | 0.00% | 0.20% | 2.38% | NA |
| Japonica Intermediate | 241 | 95.40% | 0.00% | 0.83% | 3.73% | NA |
| VI/Aromatic | 96 | 20.80% | 4.20% | 70.83% | 4.17% | NA |
| Intermediate | 90 | 56.70% | 0.00% | 7.78% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1101195615 | T -> DEL | N | N | silent_mutation | Average:15.409; most accessible tissue: Minghui63 flower, score: 26.71 | N | N | N | N |
| vg1101195615 | T -> C | LOC_Os11g03250.1 | downstream_gene_variant ; 651.0bp to feature; MODIFIER | silent_mutation | Average:15.409; most accessible tissue: Minghui63 flower, score: 26.71 | N | N | N | N |
| vg1101195615 | T -> C | LOC_Os11g03260.1 | downstream_gene_variant ; 683.0bp to feature; MODIFIER | silent_mutation | Average:15.409; most accessible tissue: Minghui63 flower, score: 26.71 | N | N | N | N |
| vg1101195615 | T -> C | LOC_Os11g03250-LOC_Os11g03260 | intergenic_region ; MODIFIER | silent_mutation | Average:15.409; most accessible tissue: Minghui63 flower, score: 26.71 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1101195615 | NA | 5.22E-10 | mr1132 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101195615 | NA | 6.23E-10 | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101195615 | NA | 1.93E-12 | mr1132_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101195615 | NA | 2.10E-12 | mr1390_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101195615 | 4.86E-06 | NA | mr1996_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101195615 | NA | 1.73E-06 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |