\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101145297:

Variant ID: vg1101145297 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 1145297
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, C: 0.15, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


GTCGCCGTCCTCGTCCCGTCCTCCTTTTTTGCCGTAGGTCGCCGGAGCACCGCCGTCCGTTGATCTTCCGCCGTTGTTTTGGTCACCGGTGAGTTCGCCG[T/C]
GTCGCCCTCTACGTGTTGGTGTCCTCTGTTCGCGCCGTCGCGCCGTCGTTCGCCGGCGAGCTTGCACGCCCGAGCCGCCGCCGGTGGTGACGTCATCGCC

Reverse complement sequence

GGCGATGACGTCACCACCGGCGGCGGCTCGGGCGTGCAAGCTCGCCGGCGAACGACGGCGCGACGGCGCGAACAGAGGACACCAACACGTAGAGGGCGAC[A/G]
CGGCGAACTCACCGGTGACCAAAACAACGGCGGAAGATCAACGGACGGCGGTGCTCCGGCGACCTACGGCAAAAAAGGAGGACGGGACGAGGACGGCGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.70% 3.50% 28.35% 29.43% NA
All Indica  2759 8.90% 5.40% 39.36% 46.32% NA
All Japonica  1512 97.60% 0.10% 1.12% 1.12% NA
Aus  269 13.00% 4.10% 61.71% 21.19% NA
Indica I  595 3.50% 5.20% 31.09% 60.17% NA
Indica II  465 18.10% 1.50% 28.17% 52.26% NA
Indica III  913 7.60% 9.40% 50.82% 32.20% NA
Indica Intermediate  786 9.00% 3.30% 38.93% 48.73% NA
Temperate Japonica  767 97.50% 0.10% 0.65% 1.69% NA
Tropical Japonica  504 98.80% 0.00% 0.60% 0.60% NA
Japonica Intermediate  241 95.40% 0.40% 3.73% 0.41% NA
VI/Aromatic  96 25.00% 2.10% 57.29% 15.62% NA
Intermediate  90 54.40% 1.10% 17.78% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1101145297 T -> DEL N N silent_mutation Average:63.366; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg1101145297 T -> C LOC_Os11g03160.1 upstream_gene_variant ; 3886.0bp to feature; MODIFIER silent_mutation Average:63.366; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg1101145297 T -> C LOC_Os11g03170.1 downstream_gene_variant ; 4105.0bp to feature; MODIFIER silent_mutation Average:63.366; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg1101145297 T -> C LOC_Os11g03160-LOC_Os11g03170 intergenic_region ; MODIFIER silent_mutation Average:63.366; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1101145297 NA 1.41E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101145297 NA 5.49E-09 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101145297 NA 6.84E-06 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101145297 NA 2.61E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101145297 3.45E-06 NA mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101145297 NA 2.60E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101145297 2.07E-06 NA mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101145297 5.42E-06 2.10E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101145297 7.75E-06 9.07E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101145297 9.90E-07 NA mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101145297 1.16E-06 8.39E-08 mr1908_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101145297 8.62E-06 NA mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101145297 NA 1.61E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251