\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101083366:

Variant ID: vg1101083366 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 1083366
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


TCAAAAATAAAAAAATAAGAATATTTAAAGAACATTATACGGTATTAATTAATTAAAATTTGAAAAAAAAATAAATTCTAAAATTAGAAAAAGAAAAAAA[G/T]
ATTTCAGTTATGAATACAATTTATAAATAACTAAATTTAGTGACAAAAAACTATTGAAAGAAAATACCATCTAAAACACATGACGAGATAAATTAAGTAA

Reverse complement sequence

TTACTTAATTTATCTCGTCATGTGTTTTAGATGGTATTTTCTTTCAATAGTTTTTTGTCACTAAATTTAGTTATTTATAAATTGTATTCATAACTGAAAT[C/A]
TTTTTTTCTTTTTCTAATTTTAGAATTTATTTTTTTTTCAAATTTTAATTAATTAATACCGTATAATGTTCTTTAAATATTCTTATTTTTTTATTTTTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.50% 40.90% 0.55% 0.00% NA
All Indica  2759 92.60% 6.60% 0.80% 0.00% NA
All Japonica  1512 1.80% 98.10% 0.07% 0.00% NA
Aus  269 52.80% 46.80% 0.37% 0.00% NA
Indica I  595 97.80% 1.50% 0.67% 0.00% NA
Indica II  465 84.50% 14.20% 1.29% 0.00% NA
Indica III  913 95.90% 3.60% 0.44% 0.00% NA
Indica Intermediate  786 89.60% 9.40% 1.02% 0.00% NA
Temperate Japonica  767 2.50% 97.50% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.00% 0.20% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 34.40% 63.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1101083366 G -> T LOC_Os11g03060.1 upstream_gene_variant ; 954.0bp to feature; MODIFIER silent_mutation Average:21.853; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1101083366 G -> T LOC_Os11g03070.1 upstream_gene_variant ; 2244.0bp to feature; MODIFIER silent_mutation Average:21.853; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1101083366 G -> T LOC_Os11g03060.2 upstream_gene_variant ; 2264.0bp to feature; MODIFIER silent_mutation Average:21.853; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1101083366 G -> T LOC_Os11g03060-LOC_Os11g03070 intergenic_region ; MODIFIER silent_mutation Average:21.853; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1101083366 NA 1.64E-12 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366 NA 1.67E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366 NA 2.02E-30 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366 NA 1.01E-11 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366 NA 7.89E-25 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366 NA 7.58E-12 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366 NA 1.19E-07 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366 NA 1.64E-09 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366 NA 1.82E-12 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366 NA 3.25E-41 mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366 NA 2.48E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366 NA 8.77E-12 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366 NA 1.20E-21 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366 NA 2.29E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366 NA 3.39E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366 NA 1.36E-16 mr1938_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251