Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101083366:

Variant ID: vg1101083366 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 1083366
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

TCAAAAATAAAAAAATAAGAATATTTAAAGAACATTATACGGTATTAATTAATTAAAATTTGAAAAAAAAATAAATTCTAAAATTAGAAAAAGAAAAAAA[G/T]
ATTTCAGTTATGAATACAATTTATAAATAACTAAATTTAGTGACAAAAAACTATTGAAAGAAAATACCATCTAAAACACATGACGAGATAAATTAAGTAA

Reverse complement sequence

TTACTTAATTTATCTCGTCATGTGTTTTAGATGGTATTTTCTTTCAATAGTTTTTTGTCACTAAATTTAGTTATTTATAAATTGTATTCATAACTGAAAT[C/A]
TTTTTTTCTTTTTCTAATTTTAGAATTTATTTTTTTTTCAAATTTTAATTAATTAATACCGTATAATGTTCTTTAAATATTCTTATTTTTTTATTTTTGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.50%	40.90%	0.55%	0.00%	NA
All Indica	2759	92.60%	6.60%	0.80%	0.00%	NA
All Japonica	1512	1.80%	98.10%	0.07%	0.00%	NA
Aus	269	52.80%	46.80%	0.37%	0.00%	NA
Indica I	595	97.80%	1.50%	0.67%	0.00%	NA
Indica II	465	84.50%	14.20%	1.29%	0.00%	NA
Indica III	913	95.90%	3.60%	0.44%	0.00%	NA
Indica Intermediate	786	89.60%	9.40%	1.02%	0.00%	NA
Temperate Japonica	767	2.50%	97.50%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	99.00%	0.20%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	10.40%	89.60%	0.00%	0.00%	NA
Intermediate	90	34.40%	63.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1101083366	G -> T	LOC_Os11g03060.1	upstream_gene_variant ; 954.0bp to feature; MODIFIER	silent_mutation	Average:21.853; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg1101083366	G -> T	LOC_Os11g03070.1	upstream_gene_variant ; 2244.0bp to feature; MODIFIER	silent_mutation	Average:21.853; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg1101083366	G -> T	LOC_Os11g03060.2	upstream_gene_variant ; 2264.0bp to feature; MODIFIER	silent_mutation	Average:21.853; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg1101083366	G -> T	LOC_Os11g03060-LOC_Os11g03070	intergenic_region ; MODIFIER	silent_mutation	Average:21.853; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1101083366	NA	1.64E-12	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366	NA	1.67E-10	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366	NA	2.02E-30	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366	NA	1.01E-11	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366	NA	7.89E-25	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366	NA	7.58E-12	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366	NA	1.19E-07	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366	NA	1.64E-09	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366	NA	1.82E-12	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366	NA	3.25E-41	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366	NA	2.48E-06	mr1403_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366	NA	8.77E-12	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366	NA	1.20E-21	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366	NA	2.29E-22	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366	NA	3.39E-15	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101083366	NA	1.36E-16	mr1938_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251