\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101063391:

Variant ID: vg1101063391 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 1063391
Reference Allele: GAlternative Allele: A,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.01, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:


TTATTAGGAATCGGCTTATATGAATAAAAAGGAAATGAGAAAATATAAGTTACCGATGGAGGCAGTATTGGTTTCTTTCTGGCAGCCGATTTCTTCTTCT[G/A,T]
CAGAGACAAGTGTTATGATGAAATTGGGATATGAAATTCTTGCAAGCATCAAGTTTTGATTAGAATACTTACCCTGGGATGCCGAGCTAGTTGAGGTGGT

Reverse complement sequence

ACCACCTCAACTAGCTCGGCATCCCAGGGTAAGTATTCTAATCAAAACTTGATGCTTGCAAGAATTTCATATCCCAATTTCATCATAACACTTGTCTCTG[C/T,A]
AGAAGAAGAAATCGGCTGCCAGAAAGAAACCAATACTGCCTCCATCGGTAACTTATATTTTCTCATTTCCTTTTTATTCATATAAGCCGATTCCTAATAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 35.00% 0.11% 2.33% NA
All Indica  2759 94.70% 3.30% 0.00% 1.99% NA
All Japonica  1512 2.30% 97.00% 0.20% 0.46% NA
Aus  269 74.30% 10.40% 0.74% 14.50% NA
Indica I  595 98.50% 0.70% 0.00% 0.84% NA
Indica II  465 85.80% 10.50% 0.00% 3.66% NA
Indica III  913 98.50% 0.50% 0.00% 0.99% NA
Indica Intermediate  786 92.70% 4.20% 0.00% 3.05% NA
Temperate Japonica  767 2.70% 97.00% 0.26% 0.00% NA
Tropical Japonica  504 1.40% 97.80% 0.20% 0.60% NA
Japonica Intermediate  241 2.90% 95.40% 0.00% 1.66% NA
VI/Aromatic  96 70.80% 25.00% 0.00% 4.17% NA
Intermediate  90 44.40% 50.00% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1101063391 G -> T LOC_Os11g03040.1 intron_variant ; MODIFIER N Average:52.206; most accessible tissue: Zhenshan97 young leaf, score: 88.513 N N N N
vg1101063391 G -> A LOC_Os11g03040.1 intron_variant ; MODIFIER silent_mutation Average:52.206; most accessible tissue: Zhenshan97 young leaf, score: 88.513 N N N N
vg1101063391 G -> DEL N N silent_mutation Average:52.206; most accessible tissue: Zhenshan97 young leaf, score: 88.513 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1101063391 NA 5.14E-45 mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 1.56E-42 mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 1.16E-31 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 1.21E-68 mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 2.28E-29 mr1226 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 6.21E-31 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 1.84E-27 mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 2.53E-53 mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 5.47E-26 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 2.38E-52 mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 7.65E-23 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 1.36E-29 mr1546 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 4.44E-50 mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 5.35E-39 mr1645 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 4.34E-38 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 4.01E-33 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 4.03E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 3.08E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 5.25E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 1.73E-11 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 1.22E-41 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 6.80E-18 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 3.55E-46 mr1546_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101063391 NA 4.67E-59 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251