Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101016914:

Variant ID: vg1101016914 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 1016914
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCGGCGCGGAAGGCGGCGGTGGTGACCTAGCAACAAAAGGGATTCCGGTGGCGGGATCGGTGGCGGCGAGGAGCAGCTCGGCGTGGAAGGTGTCGGCGG[C/T]
AGGGATCGATGGCGGCGAGGAGCAGCTCGGCGTGGAAGGTGTCGGCGGCAGGGATCGGTGGCGGCGAGGAGCAGCTCGGCGTGGAAGGCGTCGGCAGCGA

Reverse complement sequence

TCGCTGCCGACGCCTTCCACGCCGAGCTGCTCCTCGCCGCCACCGATCCCTGCCGCCGACACCTTCCACGCCGAGCTGCTCCTCGCCGCCATCGATCCCT[G/A]
CCGCCGACACCTTCCACGCCGAGCTGCTCCTCGCCGCCACCGATCCCGCCACCGGAATCCCTTTTGTTGCTAGGTCACCACCGCCGCCTTCCGCGCCGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.50%	19.80%	23.99%	10.64%	NA
All Indica	2759	17.50%	30.40%	37.01%	15.08%	NA
All Japonica	1512	97.90%	0.70%	0.66%	0.79%	NA
Aus	269	39.80%	21.20%	18.96%	20.07%	NA
Indica I	595	2.70%	28.20%	53.78%	15.29%	NA
Indica II	465	23.70%	25.80%	37.42%	13.12%	NA
Indica III	913	23.90%	34.40%	26.29%	15.44%	NA
Indica Intermediate	786	17.60%	30.30%	36.51%	15.65%	NA
Temperate Japonica	767	97.80%	1.00%	0.78%	0.39%	NA
Tropical Japonica	504	98.60%	0.00%	0.40%	0.99%	NA
Japonica Intermediate	241	96.70%	0.80%	0.83%	1.66%	NA
VI/Aromatic	96	32.30%	15.60%	38.54%	13.54%	NA
Intermediate	90	57.80%	16.70%	16.67%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1101016914	C -> T	LOC_Os11g02940.1	missense_variant ; p.Ala46Val; MODERATE	nonsynonymous_codon ; A46V	Average:68.119; most accessible tissue: Zhenshan97 panicle, score: 88.062	unknown	unknown	TOLERATED	0.30
vg1101016914	C -> DEL	LOC_Os11g02940.1	N	frameshift_variant	Average:68.119; most accessible tissue: Zhenshan97 panicle, score: 88.062	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1101016914	7.87E-06	1.65E-20	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	4.27E-18	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	4.72E-19	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	6.76E-13	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	2.92E-06	2.19E-22	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	9.90E-20	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	6.33E-07	1.40E-18	mr1132	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	1.14E-15	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	5.57E-18	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	5.12E-31	mr1243	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	1.03E-19	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	9.13E-27	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	4.36E-09	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	1.87E-18	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	6.36E-15	mr1491	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	6.94E-09	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	4.88E-52	mr1599	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	1.00E-09	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	2.12E-06	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	1.81E-20	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	1.26E-14	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	8.09E-06	6.18E-22	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	6.62E-19	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	2.81E-19	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	3.48E-23	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	7.76E-34	mr1257_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	1.42E-06	5.85E-23	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	1.19E-11	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	4.16E-06	2.57E-21	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914	NA	6.31E-15	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251