\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101016914:

Variant ID: vg1101016914 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 1016914
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCGGCGCGGAAGGCGGCGGTGGTGACCTAGCAACAAAAGGGATTCCGGTGGCGGGATCGGTGGCGGCGAGGAGCAGCTCGGCGTGGAAGGTGTCGGCGG[C/T]
AGGGATCGATGGCGGCGAGGAGCAGCTCGGCGTGGAAGGTGTCGGCGGCAGGGATCGGTGGCGGCGAGGAGCAGCTCGGCGTGGAAGGCGTCGGCAGCGA

Reverse complement sequence

TCGCTGCCGACGCCTTCCACGCCGAGCTGCTCCTCGCCGCCACCGATCCCTGCCGCCGACACCTTCCACGCCGAGCTGCTCCTCGCCGCCATCGATCCCT[G/A]
CCGCCGACACCTTCCACGCCGAGCTGCTCCTCGCCGCCACCGATCCCGCCACCGGAATCCCTTTTGTTGCTAGGTCACCACCGCCGCCTTCCGCGCCGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.50% 19.80% 23.99% 10.64% NA
All Indica  2759 17.50% 30.40% 37.01% 15.08% NA
All Japonica  1512 97.90% 0.70% 0.66% 0.79% NA
Aus  269 39.80% 21.20% 18.96% 20.07% NA
Indica I  595 2.70% 28.20% 53.78% 15.29% NA
Indica II  465 23.70% 25.80% 37.42% 13.12% NA
Indica III  913 23.90% 34.40% 26.29% 15.44% NA
Indica Intermediate  786 17.60% 30.30% 36.51% 15.65% NA
Temperate Japonica  767 97.80% 1.00% 0.78% 0.39% NA
Tropical Japonica  504 98.60% 0.00% 0.40% 0.99% NA
Japonica Intermediate  241 96.70% 0.80% 0.83% 1.66% NA
VI/Aromatic  96 32.30% 15.60% 38.54% 13.54% NA
Intermediate  90 57.80% 16.70% 16.67% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1101016914 C -> T LOC_Os11g02940.1 missense_variant ; p.Ala46Val; MODERATE nonsynonymous_codon ; A46V Average:68.119; most accessible tissue: Zhenshan97 panicle, score: 88.062 unknown unknown TOLERATED 0.30
vg1101016914 C -> DEL LOC_Os11g02940.1 N frameshift_variant Average:68.119; most accessible tissue: Zhenshan97 panicle, score: 88.062 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1101016914 7.87E-06 1.65E-20 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 4.27E-18 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 4.72E-19 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 6.76E-13 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 2.92E-06 2.19E-22 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 9.90E-20 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 6.33E-07 1.40E-18 mr1132 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 1.14E-15 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 5.57E-18 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 5.12E-31 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 1.03E-19 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 9.13E-27 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 4.36E-09 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 1.87E-18 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 6.36E-15 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 6.94E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 4.88E-52 mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 1.00E-09 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 2.12E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 1.81E-20 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 1.26E-14 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 8.09E-06 6.18E-22 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 6.62E-19 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 2.81E-19 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 3.48E-23 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 7.76E-34 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 1.42E-06 5.85E-23 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 1.19E-11 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 4.16E-06 2.57E-21 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101016914 NA 6.31E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251