\
| Variant ID: vg1100991046 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 991046 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.16, others allele: 0.00, population size: 76. )
AGGTGAGGTACATGAGGGAATTTGTGTTACTCATCAATCGGCTCACAAGATGAAGTGGTTACTTTGGCGTGCAGGGTATTTTTGGCCGACAATGTTGGAA[G/A,T]
ATTGTTTCAGATATTATAGAGGATGTCAAGATTGTCAAAAATTTGGAGCAATTCAAAGAGCACCAGCATCGGCTATGAATCCTATTATCAAGCCGTGGCC
GGCCACGGCTTGATAATAGGATTCATAGCCGATGCTGGTGCTCTTTGAATTGCTCCAAATTTTTGACAATCTTGACATCCTCTATAATATCTGAAACAAT[C/T,A]
TTCCAACATTGTCGGCCAAAAATACCCTGCACGCCAAAGTAACCACTTCATCTTGTGAGCCGATTGATGAGTAACACAAATTCCCTCATGTACCTCACCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.30% | 35.90% | 0.42% | 3.41% | NA |
| All Indica | 2759 | 92.90% | 4.50% | 0.36% | 2.28% | NA |
| All Japonica | 1512 | 2.00% | 97.70% | 0.00% | 0.33% | NA |
| Aus | 269 | 56.10% | 8.60% | 3.72% | 31.60% | NA |
| Indica I | 595 | 97.30% | 2.00% | 0.50% | 0.17% | NA |
| Indica II | 465 | 84.10% | 13.30% | 0.65% | 1.94% | NA |
| Indica III | 913 | 96.90% | 0.30% | 0.22% | 2.52% | NA |
| Indica Intermediate | 786 | 90.10% | 5.90% | 0.25% | 3.82% | NA |
| Temperate Japonica | 767 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 98.60% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 2.50% | 96.30% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 69.80% | 25.00% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 41.10% | 55.60% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1100991046 | G -> T | LOC_Os11g02890.1 | missense_variant ; p.Lys1034Asn; MODERATE | N | Average:31.671; most accessible tissue: Zhenshan97 young leaf, score: 43.913 | N | N | N | N |
| vg1100991046 | G -> A | LOC_Os11g02890.1 | synonymous_variant ; p.Lys1034Lys; LOW | nonsynonymous_codon ; K1034I | Average:31.671; most accessible tissue: Zhenshan97 young leaf, score: 43.913 | unknown | unknown | DELETERIOUS | 0.02 |
| vg1100991046 | G -> DEL | LOC_Os11g02890.1 | N | frameshift_variant | Average:31.671; most accessible tissue: Zhenshan97 young leaf, score: 43.913 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1100991046 | NA | 3.93E-07 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100991046 | NA | 6.57E-29 | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100991046 | NA | 2.84E-06 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100991046 | 4.65E-06 | 1.13E-37 | mr1243 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100991046 | NA | 5.28E-07 | mr1243 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100991046 | NA | 1.84E-26 | mr1251 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100991046 | NA | 4.67E-31 | mr1257 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100991046 | NA | 5.63E-06 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100991046 | NA | 1.47E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100991046 | NA | 4.03E-27 | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100991046 | NA | 4.42E-36 | mr1435 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100991046 | NA | 2.71E-22 | mr1888 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100991046 | NA | 2.42E-13 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100991046 | NA | 2.91E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |