Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100988116:

Variant ID: vg1100988116 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 988116
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, C: 0.13, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:

GCTGATGAGATCGAAGGTGACAAGACAAAAAGGTTGCTTAAGGGCAAAGCTGGTACATCTGCCTCAATAAATATGGTTTTCATGTTACCTGCAGAATTCG[A/C]
GGCTAGGCAAGCCGATGTTGATGATGTTGAAGAAGCTTCGGCTAAATTGGTTTGTCTCGAGAGCAAGCAGTTTTTGAGAAGCCAGAAGGGACAGAGAATC

Reverse complement sequence

GATTCTCTGTCCCTTCTGGCTTCTCAAAAACTGCTTGCTCTCGAGACAAACCAATTTAGCCGAAGCTTCTTCAACATCATCAACATCGGCTTGCCTAGCC[T/G]
CGAATTCTGCAGGTAACATGAAAACCATATTTATTGAGGCAGATGTACCAGCTTTGCCCTTAAGCAACCTTTTTGTCTTGTCACCTTCGATCTCATCAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.30%	35.90%	1.33%	2.45%	NA
All Indica	2759	93.00%	3.90%	1.70%	1.34%	NA
All Japonica	1512	2.00%	97.70%	0.13%	0.20%	NA
Aus	269	56.50%	13.80%	4.09%	25.65%	NA
Indica I	595	97.30%	0.80%	1.51%	0.34%	NA
Indica II	465	84.30%	12.70%	1.51%	1.51%	NA
Indica III	913	96.90%	0.50%	1.53%	0.99%	NA
Indica Intermediate	786	90.50%	5.00%	2.16%	2.42%	NA
Temperate Japonica	767	2.50%	97.50%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	98.60%	0.20%	0.20%	NA
Japonica Intermediate	241	2.50%	96.30%	0.41%	0.83%	NA
VI/Aromatic	96	68.80%	25.00%	1.04%	5.21%	NA
Intermediate	90	40.00%	55.60%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1100988116	A -> DEL	N	N	silent_mutation	Average:40.306; most accessible tissue: Zhenshan97 young leaf, score: 74.302	N	N	N	N
vg1100988116	A -> C	LOC_Os11g02880.1	downstream_gene_variant ; 4169.0bp to feature; MODIFIER	silent_mutation	Average:40.306; most accessible tissue: Zhenshan97 young leaf, score: 74.302	N	N	N	N
vg1100988116	A -> C	LOC_Os11g02890.1	intron_variant ; MODIFIER	silent_mutation	Average:40.306; most accessible tissue: Zhenshan97 young leaf, score: 74.302	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1100988116	NA	2.39E-10	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	1.75E-09	mr1093	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	8.25E-06	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	1.44E-11	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	2.41E-07	mr1235	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	7.79E-07	mr1241	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	5.40E-32	mr1243	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	3.38E-06	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	1.80E-06	1.14E-06	mr1395	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	1.11E-25	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	1.97E-06	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	3.38E-06	mr1435	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	9.41E-06	mr1446	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	2.59E-09	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	8.52E-22	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	1.88E-06	mr1599	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	9.41E-06	NA	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	2.95E-34	mr1733	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	9.25E-30	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	2.99E-07	NA	mr1758	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	3.59E-06	NA	mr1758	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	1.76E-08	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	1.26E-10	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	9.00E-14	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	1.76E-12	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	5.67E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988116	NA	8.77E-08	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251