\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100973405:

Variant ID: vg1100973405 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 973405
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGATTGAGTCCTGAATAGGCAATTGTATCTATTAATTAGGATATTTTATGTAATTTCCTTAGAGATAAGTGTGGGCAAATGTCTGCCGCAAAGATTTATG[G/T]
TATGTTAGAGTTTGTTAGAGATAAGAGTCGTGTCCGACAAGGACATATTGTGTAATCTCGGGTATAAATAGACCCCGAGCCCCATGTAATACAACAACAG

Reverse complement sequence

CTGTTGTTGTATTACATGGGGCTCGGGGTCTATTTATACCCGAGATTACACAATATGTCCTTGTCGGACACGACTCTTATCTCTAACAAACTCTAACATA[C/A]
CATAAATCTTTGCGGCAGACATTTGCCCACACTTATCTCTAAGGAAATTACATAAAATATCCTAATTAATAGATACAATTGCCTATTCAGGACTCAATCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.80% 2.20% 6.64% 5.40% NA
All Indica  2759 81.40% 0.80% 9.24% 8.63% NA
All Japonica  1512 93.10% 5.00% 0.99% 0.86% NA
Aus  269 89.20% 0.00% 10.41% 0.37% NA
Indica I  595 75.80% 0.00% 15.46% 8.74% NA
Indica II  465 72.70% 1.10% 11.83% 14.41% NA
Indica III  913 93.20% 0.00% 2.08% 4.71% NA
Indica Intermediate  786 77.00% 2.00% 11.32% 9.67% NA
Temperate Japonica  767 98.00% 0.10% 0.39% 1.43% NA
Tropical Japonica  504 83.70% 14.50% 1.79% 0.00% NA
Japonica Intermediate  241 97.10% 0.80% 1.24% 0.83% NA
VI/Aromatic  96 90.60% 0.00% 9.38% 0.00% NA
Intermediate  90 83.30% 5.60% 7.78% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100973405 G -> T LOC_Os11g02860.1 upstream_gene_variant ; 3021.0bp to feature; MODIFIER silent_mutation Average:32.278; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1100973405 G -> T LOC_Os11g02870.1 upstream_gene_variant ; 1223.0bp to feature; MODIFIER silent_mutation Average:32.278; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1100973405 G -> T LOC_Os11g02880.1 upstream_gene_variant ; 2428.0bp to feature; MODIFIER silent_mutation Average:32.278; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1100973405 G -> T LOC_Os11g02860-LOC_Os11g02870 intergenic_region ; MODIFIER silent_mutation Average:32.278; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1100973405 G -> DEL N N silent_mutation Average:32.278; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100973405 2.34E-07 4.27E-09 mr1498_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251