Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100973405:

Variant ID: vg1100973405 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 973405
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGATTGAGTCCTGAATAGGCAATTGTATCTATTAATTAGGATATTTTATGTAATTTCCTTAGAGATAAGTGTGGGCAAATGTCTGCCGCAAAGATTTATG[G/T]
TATGTTAGAGTTTGTTAGAGATAAGAGTCGTGTCCGACAAGGACATATTGTGTAATCTCGGGTATAAATAGACCCCGAGCCCCATGTAATACAACAACAG

Reverse complement sequence

CTGTTGTTGTATTACATGGGGCTCGGGGTCTATTTATACCCGAGATTACACAATATGTCCTTGTCGGACACGACTCTTATCTCTAACAAACTCTAACATA[C/A]
CATAAATCTTTGCGGCAGACATTTGCCCACACTTATCTCTAAGGAAATTACATAAAATATCCTAATTAATAGATACAATTGCCTATTCAGGACTCAATCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.80%	2.20%	6.64%	5.40%	NA
All Indica	2759	81.40%	0.80%	9.24%	8.63%	NA
All Japonica	1512	93.10%	5.00%	0.99%	0.86%	NA
Aus	269	89.20%	0.00%	10.41%	0.37%	NA
Indica I	595	75.80%	0.00%	15.46%	8.74%	NA
Indica II	465	72.70%	1.10%	11.83%	14.41%	NA
Indica III	913	93.20%	0.00%	2.08%	4.71%	NA
Indica Intermediate	786	77.00%	2.00%	11.32%	9.67%	NA
Temperate Japonica	767	98.00%	0.10%	0.39%	1.43%	NA
Tropical Japonica	504	83.70%	14.50%	1.79%	0.00%	NA
Japonica Intermediate	241	97.10%	0.80%	1.24%	0.83%	NA
VI/Aromatic	96	90.60%	0.00%	9.38%	0.00%	NA
Intermediate	90	83.30%	5.60%	7.78%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1100973405	G -> T	LOC_Os11g02860.1	upstream_gene_variant ; 3021.0bp to feature; MODIFIER	silent_mutation	Average:32.278; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1100973405	G -> T	LOC_Os11g02870.1	upstream_gene_variant ; 1223.0bp to feature; MODIFIER	silent_mutation	Average:32.278; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1100973405	G -> T	LOC_Os11g02880.1	upstream_gene_variant ; 2428.0bp to feature; MODIFIER	silent_mutation	Average:32.278; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1100973405	G -> T	LOC_Os11g02860-LOC_Os11g02870	intergenic_region ; MODIFIER	silent_mutation	Average:32.278; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1100973405	G -> DEL	N	N	silent_mutation	Average:32.278; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1100973405	2.34E-07	4.27E-09	mr1498_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251