| Variant ID: vg1100922069 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 922069 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGGTCTGACACAATCTTTTTGGGGCAGCCAAATCTACATACGACATGGGTCATGTAGAGTTCTGCTAGCTTCTTTCCATCAAAGGTGGTTTTCACTGGCA[C/T]
GAAATGAGCTGATTTCGTGAGTCGATCCACGATTACCTAGATGGAGTCGTACCCGCTAGGGGTTGTTGGCAAGCCGGTGATGAAATCCATTCCGATCTCT
AGAGATCGGAATGGATTTCATCACCGGCTTGCCAACAACCCCTAGCGGGTACGACTCCATCTAGGTAATCGTGGATCGACTCACGAAATCAGCTCATTTC[G/A]
TGCCAGTGAAAACCACCTTTGATGGAAAGAAGCTAGCAGAACTCTACATGACCCATGTCGTATGTAGATTTGGCTGCCCCAAAAAGATTGTGTCAGACCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.70% | 1.50% | 0.61% | 0.15% | NA |
| All Indica | 2759 | 99.70% | 0.00% | 0.22% | 0.04% | NA |
| All Japonica | 1512 | 93.70% | 4.60% | 1.32% | 0.40% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.00% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 93.50% | 4.00% | 1.83% | 0.65% | NA |
| Tropical Japonica | 504 | 93.50% | 6.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 3.30% | 1.66% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 2.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1100922069 | C -> T | LOC_Os11g02778.1 | upstream_gene_variant ; 4585.0bp to feature; MODIFIER | silent_mutation | Average:39.166; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| vg1100922069 | C -> T | LOC_Os11g02780.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.166; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| vg1100922069 | C -> DEL | N | N | silent_mutation | Average:39.166; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1100922069 | 7.16E-06 | 2.08E-06 | mr1143 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100922069 | 5.90E-07 | 6.14E-08 | mr1030_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100922069 | 1.15E-06 | 2.19E-06 | mr1331_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100922069 | 2.92E-08 | 1.28E-08 | mr1444_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100922069 | 3.58E-06 | 3.58E-06 | mr1754_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100922069 | 1.64E-08 | 2.43E-09 | mr1965_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/