Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100909838:

Variant ID: vg1100909838 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 909838
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGTGTGTAGGGCCTCCGGCAGATACGGTCCATGACAACGACCATAGCCATGACGACCGCGACATCGACGCCTGGCCTGACGACGAGGGTGAACACGTC[G/A]
TCGCCGAGGCTGACCGGTCTGGACATCACGCCGGCGTTCTTCCTCGTGATCCGCGCTGCCTCCTCGCCGTTGCTGCCACGGATCTTGCAGCTCCTCATGG

Reverse complement sequence

CCATGAGGAGCTGCAAGATCCGTGGCAGCAACGGCGAGGAGGCAGCGCGGATCACGAGGAAGAACGCCGGCGTGATGTCCAGACCGGTCAGCCTCGGCGA[C/T]
GACGTGTTCACCCTCGTCGTCAGGCCAGGCGTCGATGTCGCGGTCGTCATGGCTATGGTCGTTGTCATGGACCGTATCTGCCGGAGGCCCTACACACCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.60% 7.80% 0.61% 0.00% NA
All Indica  2759 98.00% 2.00% 0.04% 0.00% NA
All Japonica  1512 78.20% 20.00% 1.79% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 89.90% 10.10% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.80% 0.13% 0.00% NA
Temperate Japonica  767 65.60% 31.40% 3.00% 0.00% NA
Tropical Japonica  504 92.30% 7.10% 0.60% 0.00% NA
Japonica Intermediate  241 88.80% 10.80% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100909838 G -> A LOC_Os11g02774.1 upstream_gene_variant ; 2641.0bp to feature; MODIFIER silent_mutation Average:74.866; most accessible tissue: Zhenshan97 flower, score: 91.792 N N N N
vg1100909838 G -> A LOC_Os11g02760.1 downstream_gene_variant ; 2007.0bp to feature; MODIFIER silent_mutation Average:74.866; most accessible tissue: Zhenshan97 flower, score: 91.792 N N N N
vg1100909838 G -> A LOC_Os11g02770.1 downstream_gene_variant ; 1639.0bp to feature; MODIFIER silent_mutation Average:74.866; most accessible tissue: Zhenshan97 flower, score: 91.792 N N N N
vg1100909838 G -> A LOC_Os11g02778.1 downstream_gene_variant ; 4977.0bp to feature; MODIFIER silent_mutation Average:74.866; most accessible tissue: Zhenshan97 flower, score: 91.792 N N N N
vg1100909838 G -> A LOC_Os11g02760-LOC_Os11g02770 intergenic_region ; MODIFIER silent_mutation Average:74.866; most accessible tissue: Zhenshan97 flower, score: 91.792 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1100909838 G A 0.09 0.13 0.07 0.02 0.09 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100909838 NA 2.06E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100909838 NA 1.26E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100909838 NA 2.21E-06 mr1030_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100909838 9.61E-06 9.60E-06 mr1162_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100909838 NA 8.84E-06 mr1173_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100909838 7.54E-06 9.18E-10 mr1754_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100909838 2.65E-07 2.65E-07 mr1754_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100909838 NA 2.06E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100909838 NA 8.05E-06 mr1965_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251