\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100903458:

Variant ID: vg1100903458 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 903458
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCTTTCTGATCTGGAAGTGAAGAGGCACGCATCTACAGCTCCCTGCCCCCACATGAAGTTTTTGGGCTTATTTGGTTTGATACCAATTTACTACCCTA[C/T]
CAAAATTTTGGCAACTTCAATAGTAGCAAGTGGATGTTTGGTTTGCTACCAAATTTTACCCACCATAGTTCAAATTGAATACTATCTAATTTGGTAGTGC

Reverse complement sequence

GCACTACCAAATTAGATAGTATTCAATTTGAACTATGGTGGGTAAAATTTGGTAGCAAACCAAACATCCACTTGCTACTATTGAAGTTGCCAAAATTTTG[G/A]
TAGGGTAGTAAATTGGTATCAAACCAAATAAGCCCAAAAACTTCATGTGGGGGCAGGGAGCTGTAGATGCGTGCCTCTTCACTTCCAGATCAGAAAGCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.30% 1.40% 1.25% 59.10% NA
All Indica  2759 5.10% 0.00% 1.20% 93.69% NA
All Japonica  1512 92.70% 4.10% 1.26% 1.92% NA
Aus  269 46.50% 0.00% 0.37% 53.16% NA
Indica I  595 2.00% 0.00% 0.84% 97.14% NA
Indica II  465 15.10% 0.00% 0.43% 84.52% NA
Indica III  913 1.10% 0.00% 1.75% 97.15% NA
Indica Intermediate  786 6.20% 0.00% 1.27% 92.49% NA
Temperate Japonica  767 92.80% 2.70% 1.96% 2.48% NA
Tropical Japonica  504 92.90% 6.30% 0.20% 0.60% NA
Japonica Intermediate  241 92.10% 3.70% 1.24% 2.90% NA
VI/Aromatic  96 89.60% 0.00% 3.12% 7.29% NA
Intermediate  90 61.10% 3.30% 3.33% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100903458 C -> T LOC_Os11g02760.1 upstream_gene_variant ; 2204.0bp to feature; MODIFIER silent_mutation Average:42.763; most accessible tissue: Minghui63 flower, score: 80.178 N N N N
vg1100903458 C -> T LOC_Os11g02750-LOC_Os11g02760 intergenic_region ; MODIFIER silent_mutation Average:42.763; most accessible tissue: Minghui63 flower, score: 80.178 N N N N
vg1100903458 C -> DEL N N silent_mutation Average:42.763; most accessible tissue: Minghui63 flower, score: 80.178 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1100903458 C T -0.03 -0.01 -0.02 -0.03 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100903458 1.01E-07 3.33E-08 mr1030_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100903458 2.97E-06 1.79E-06 mr1267_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100903458 6.22E-06 6.22E-06 mr1329_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100903458 9.31E-06 6.61E-06 mr1331_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100903458 1.75E-06 1.75E-06 mr1442_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100903458 1.34E-07 5.61E-08 mr1444_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100903458 4.32E-06 4.32E-06 mr1524_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100903458 6.72E-08 6.72E-08 mr1754_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100903458 7.23E-07 8.69E-07 mr1891_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100903458 5.07E-09 1.12E-09 mr1965_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251