\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100882780:

Variant ID: vg1100882780 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 882780
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGCTGGCTCGTTAACCTACCGAGCCAGAGCGAGTCGAGCCGAGCCGAGCTGGCTCGATATCCAACCCTAGATATGTACTACTCCGTCCCAAAAAGAATC[C/T]
AATCCTAGCAACGAATCTGGACACACATGTGTCTAGATTCATTGCTAGAGTTTGTCTTTTTTTGGACGGAGGGGGTATAGTATAGGCACACCTATTCCGC

Reverse complement sequence

GCGGAATAGGTGTGCCTATACTATACCCCCTCCGTCCAAAAAAAGACAAACTCTAGCAATGAATCTAGACACATGTGTGTCCAGATTCGTTGCTAGGATT[G/A]
GATTCTTTTTGGGACGGAGTAGTACATATCTAGGGTTGGATATCGAGCCAGCTCGGCTCGGCTCGACTCGCTCTGGCTCGGTAGGTTAACGAGCCAGCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.90% 19.90% 1.23% 0.00% NA
All Indica  2759 98.70% 1.30% 0.00% 0.00% NA
All Japonica  1512 51.20% 45.40% 3.37% 0.00% NA
Aus  269 59.10% 39.40% 1.49% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 96.80% 3.20% 0.00% 0.00% NA
Temperate Japonica  767 83.80% 12.60% 3.52% 0.00% NA
Tropical Japonica  504 10.70% 86.90% 2.38% 0.00% NA
Japonica Intermediate  241 32.00% 63.10% 4.98% 0.00% NA
VI/Aromatic  96 20.80% 79.20% 0.00% 0.00% NA
Intermediate  90 60.00% 36.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100882780 C -> T LOC_Os11g02710.1 downstream_gene_variant ; 3534.0bp to feature; MODIFIER silent_mutation Average:80.752; most accessible tissue: Minghui63 root, score: 90.555 N N N N
vg1100882780 C -> T LOC_Os11g02730.1 downstream_gene_variant ; 3462.0bp to feature; MODIFIER silent_mutation Average:80.752; most accessible tissue: Minghui63 root, score: 90.555 N N N N
vg1100882780 C -> T LOC_Os11g02720.1 intron_variant ; MODIFIER silent_mutation Average:80.752; most accessible tissue: Minghui63 root, score: 90.555 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1100882780 C T 0.03 0.0 0.01 0.04 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100882780 NA 2.07E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1100882780 NA 1.33E-09 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100882780 NA 1.53E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100882780 NA 3.13E-08 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100882780 NA 1.26E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100882780 NA 6.32E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100882780 8.56E-07 NA mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100882780 NA 5.98E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100882780 NA 5.11E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100882780 NA 5.13E-08 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100882780 NA 1.35E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100882780 NA 6.36E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100882780 NA 4.28E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100882780 3.99E-07 NA mr1745_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100882780 4.11E-06 NA mr1821_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251