\
| Variant ID: vg1100842464 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 842464 |
| Reference Allele: T | Alternative Allele: G,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.04, others allele: 0.00, population size: 123. )
CTTATGGGCTAGTTTGGTTTGTGAACTAAATTGGCCTTACCAATTTTTATCAATGCTAAATTTTGGTAAGTTTTGGCATGGCTAATTTTGGCAAGATAAA[T/G,A]
TTATGTTTGGATTGAAGCCAAAATAGTCTAAGTTAACTATTGAAATGGCCTATTTTCTTAGGCATGTCAAAATTTGGCTTCAAACCAAATAGACACTAAA
TTTAGTGTCTATTTGGTTTGAAGCCAAATTTTGACATGCCTAAGAAAATAGGCCATTTCAATAGTTAACTTAGACTATTTTGGCTTCAATCCAAACATAA[A/C,T]
TTTATCTTGCCAAAATTAGCCATGCCAAAACTTACCAAAATTTAGCATTGATAAAAATTGGTAAGGCCAATTTAGTTCACAAACCAAACTAGCCCATAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.60% | 38.50% | 0.15% | 0.70% | A: 0.02% |
| All Indica | 2759 | 95.50% | 3.30% | 0.14% | 0.98% | NA |
| All Japonica | 1512 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 58.40% | 41.30% | 0.00% | 0.37% | NA |
| Indica I | 595 | 97.60% | 0.50% | 0.50% | 1.34% | NA |
| Indica II | 465 | 86.50% | 12.00% | 0.00% | 1.51% | NA |
| Indica III | 913 | 99.70% | 0.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 94.50% | 3.90% | 0.00% | 1.53% | NA |
| Temperate Japonica | 767 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.60% | 99.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 88.50% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 35.60% | 58.90% | 2.22% | 2.22% | A: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1100842464 | T -> DEL | N | N | silent_mutation | Average:57.684; most accessible tissue: Minghui63 root, score: 87.205 | N | N | N | N |
| vg1100842464 | T -> A | LOC_Os11g02630.1 | upstream_gene_variant ; 2555.0bp to feature; MODIFIER | silent_mutation | Average:57.684; most accessible tissue: Minghui63 root, score: 87.205 | N | N | N | N |
| vg1100842464 | T -> A | LOC_Os11g02640.1 | downstream_gene_variant ; 2689.0bp to feature; MODIFIER | silent_mutation | Average:57.684; most accessible tissue: Minghui63 root, score: 87.205 | N | N | N | N |
| vg1100842464 | T -> A | LOC_Os11g02630-LOC_Os11g02640 | intergenic_region ; MODIFIER | silent_mutation | Average:57.684; most accessible tissue: Minghui63 root, score: 87.205 | N | N | N | N |
| vg1100842464 | T -> G | LOC_Os11g02630.1 | upstream_gene_variant ; 2555.0bp to feature; MODIFIER | silent_mutation | Average:57.684; most accessible tissue: Minghui63 root, score: 87.205 | N | N | N | N |
| vg1100842464 | T -> G | LOC_Os11g02640.1 | downstream_gene_variant ; 2689.0bp to feature; MODIFIER | silent_mutation | Average:57.684; most accessible tissue: Minghui63 root, score: 87.205 | N | N | N | N |
| vg1100842464 | T -> G | LOC_Os11g02630-LOC_Os11g02640 | intergenic_region ; MODIFIER | silent_mutation | Average:57.684; most accessible tissue: Minghui63 root, score: 87.205 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1100842464 | NA | 2.06E-15 | mr1016 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 9.67E-13 | mr1017 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 7.45E-06 | mr1018 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 4.23E-14 | mr1022 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 1.90E-13 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 2.38E-16 | mr1055 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 4.49E-16 | mr1079 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 3.18E-40 | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 7.24E-09 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 2.37E-06 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 4.07E-10 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 9.02E-08 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 9.00E-16 | mr1132 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 5.65E-15 | mr1142 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 3.62E-15 | mr1178 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 1.11E-08 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 1.22E-06 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 2.78E-06 | mr1241 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 1.28E-08 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 3.69E-10 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 1.77E-15 | mr1390 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 4.26E-07 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 2.36E-08 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 1.12E-10 | mr1489 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 1.18E-14 | mr1490 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 2.85E-14 | mr1491 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 1.78E-06 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 3.75E-46 | mr1519 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 4.45E-10 | mr1546 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 1.55E-49 | mr1558 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 4.16E-06 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 1.65E-06 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 2.12E-24 | mr1731 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 5.21E-11 | mr1805 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 2.29E-11 | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 1.46E-13 | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 2.91E-13 | mr1079_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 1.86E-08 | mr1093_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 2.33E-13 | mr1132_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 5.11E-15 | mr1178_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 8.50E-08 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 7.56E-15 | mr1390_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 3.87E-08 | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 2.66E-14 | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 1.25E-08 | mr1599_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 7.06E-06 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100842464 | NA | 2.78E-08 | mr1993_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |