\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100781807:

Variant ID: vg1100781807 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 781807
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TACCATTAATGTATTATTTAGAATTTCAAGTATTTTGCGTGATACAGAAATAACTGCCAAACTTACTCAGAATCACTTTTCCATATCCAGCACTGCATTG[A/G]
CATTGCAACATATGTATCTACCACATAGGATTTCTAATTTGAGATATTAACTAGAAAAAATGCCCGTGTGTTGCAACGGGTGAAGTCTATTTTAATCTTA

Reverse complement sequence

TAAGATTAAAATAGACTTCACCCGTTGCAACACACGGGCATTTTTTCTAGTTAATATCTCAAATTAGAAATCCTATGTGGTAGATACATATGTTGCAATG[T/C]
CAATGCAGTGCTGGATATGGAAAAGTGATTCTGAGTAAGTTTGGCAGTTATTTCTGTATCACGCAAAATACTTGAAATTCTAAATAATACATTAATGGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 40.20% 0.36% 0.00% NA
All Indica  2759 95.50% 4.00% 0.47% 0.00% NA
All Japonica  1512 2.20% 97.70% 0.13% 0.00% NA
Aus  269 36.10% 63.90% 0.00% 0.00% NA
Indica I  595 98.30% 0.70% 1.01% 0.00% NA
Indica II  465 86.90% 12.50% 0.65% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 94.50% 5.00% 0.51% 0.00% NA
Temperate Japonica  767 2.60% 97.40% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 95.40% 0.83% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 38.90% 58.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100781807 A -> G LOC_Os11g02500.1 downstream_gene_variant ; 4238.0bp to feature; MODIFIER silent_mutation Average:47.122; most accessible tissue: Callus, score: 67.624 N N N N
vg1100781807 A -> G LOC_Os11g02510.1 downstream_gene_variant ; 3045.0bp to feature; MODIFIER silent_mutation Average:47.122; most accessible tissue: Callus, score: 67.624 N N N N
vg1100781807 A -> G LOC_Os11g02520.1 downstream_gene_variant ; 551.0bp to feature; MODIFIER silent_mutation Average:47.122; most accessible tissue: Callus, score: 67.624 N N N N
vg1100781807 A -> G LOC_Os11g02510-LOC_Os11g02520 intergenic_region ; MODIFIER silent_mutation Average:47.122; most accessible tissue: Callus, score: 67.624 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100781807 NA 4.26E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807 NA 6.79E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807 NA 5.07E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807 1.55E-06 3.30E-28 mr1298 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807 NA 1.13E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807 NA 1.91E-51 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807 NA 1.47E-19 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807 1.42E-06 NA mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807 NA 9.87E-14 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807 NA 6.96E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807 NA 2.37E-44 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807 NA 4.42E-56 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251