\
| Variant ID: vg1100781807 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 781807 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 108. )
TACCATTAATGTATTATTTAGAATTTCAAGTATTTTGCGTGATACAGAAATAACTGCCAAACTTACTCAGAATCACTTTTCCATATCCAGCACTGCATTG[A/G]
CATTGCAACATATGTATCTACCACATAGGATTTCTAATTTGAGATATTAACTAGAAAAAATGCCCGTGTGTTGCAACGGGTGAAGTCTATTTTAATCTTA
TAAGATTAAAATAGACTTCACCCGTTGCAACACACGGGCATTTTTTCTAGTTAATATCTCAAATTAGAAATCCTATGTGGTAGATACATATGTTGCAATG[T/C]
CAATGCAGTGCTGGATATGGAAAAGTGATTCTGAGTAAGTTTGGCAGTTATTTCTGTATCACGCAAAATACTTGAAATTCTAAATAATACATTAATGGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.40% | 40.20% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 95.50% | 4.00% | 0.47% | 0.00% | NA |
| All Japonica | 1512 | 2.20% | 97.70% | 0.13% | 0.00% | NA |
| Aus | 269 | 36.10% | 63.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 0.70% | 1.01% | 0.00% | NA |
| Indica II | 465 | 86.90% | 12.50% | 0.65% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.50% | 5.00% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 95.40% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 58.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1100781807 | A -> G | LOC_Os11g02500.1 | downstream_gene_variant ; 4238.0bp to feature; MODIFIER | silent_mutation | Average:47.122; most accessible tissue: Callus, score: 67.624 | N | N | N | N |
| vg1100781807 | A -> G | LOC_Os11g02510.1 | downstream_gene_variant ; 3045.0bp to feature; MODIFIER | silent_mutation | Average:47.122; most accessible tissue: Callus, score: 67.624 | N | N | N | N |
| vg1100781807 | A -> G | LOC_Os11g02520.1 | downstream_gene_variant ; 551.0bp to feature; MODIFIER | silent_mutation | Average:47.122; most accessible tissue: Callus, score: 67.624 | N | N | N | N |
| vg1100781807 | A -> G | LOC_Os11g02510-LOC_Os11g02520 | intergenic_region ; MODIFIER | silent_mutation | Average:47.122; most accessible tissue: Callus, score: 67.624 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1100781807 | NA | 4.26E-15 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100781807 | NA | 6.79E-11 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100781807 | NA | 5.07E-08 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100781807 | 1.55E-06 | 3.30E-28 | mr1298 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100781807 | NA | 1.13E-12 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100781807 | NA | 1.91E-51 | mr1558 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100781807 | NA | 1.47E-19 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100781807 | 1.42E-06 | NA | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100781807 | NA | 9.87E-14 | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100781807 | NA | 6.96E-17 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100781807 | NA | 2.37E-44 | mr1509_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100781807 | NA | 4.42E-56 | mr1558_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |