Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100738560:

Variant ID: vg1100738560 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 738560
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, G: 0.07, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

AAAATCTTATTTCCATCCCATTACCAGGTTTAAAAGATCCATACTGAAAAAAATATGATCTTTTACTTTCATTAGGCCAGCCCAAAATTAGAATGTTCCT[T/G]
GTTGTGTCCTCTAATCCTATATTACTATAAAGTTATTCCCACTAACTCCTTAAGCTTAACATGCAAAGATGCCACATCACCATCCACTAATTAACAAGAT

Reverse complement sequence

ATCTTGTTAATTAGTGGATGGTGATGTGGCATCTTTGCATGTTAAGCTTAAGGAGTTAGTGGGAATAACTTTATAGTAATATAGGATTAGAGGACACAAC[A/C]
AGGAACATTCTAATTTTGGGCTGGCCTAATGAAAGTAAAAGATCATATTTTTTTCAGTATGGATCTTTTAAACCTGGTAATGGGATGGAAATAAGATTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.90%	40.10%	0.04%	0.00%	NA
All Indica	2759	96.10%	3.80%	0.07%	0.00%	NA
All Japonica	1512	2.10%	97.90%	0.00%	0.00%	NA
Aus	269	38.30%	61.70%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	87.50%	12.30%	0.22%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	94.80%	5.10%	0.13%	0.00%	NA
Temperate Japonica	767	2.50%	97.50%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	99.20%	0.00%	0.00%	NA
Japonica Intermediate	241	3.70%	96.30%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	41.10%	58.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1100738560	T -> G	LOC_Os11g02450.1	downstream_gene_variant ; 1372.0bp to feature; MODIFIER	silent_mutation	Average:29.716; most accessible tissue: Callus, score: 44.955	N	N	N	N
vg1100738560	T -> G	LOC_Os11g02464.1	downstream_gene_variant ; 4233.0bp to feature; MODIFIER	silent_mutation	Average:29.716; most accessible tissue: Callus, score: 44.955	N	N	N	N
vg1100738560	T -> G	LOC_Os11g02460.3	downstream_gene_variant ; 536.0bp to feature; MODIFIER	silent_mutation	Average:29.716; most accessible tissue: Callus, score: 44.955	N	N	N	N
vg1100738560	T -> G	LOC_Os11g02460.1	intron_variant ; MODIFIER	silent_mutation	Average:29.716; most accessible tissue: Callus, score: 44.955	N	N	N	N
vg1100738560	T -> G	LOC_Os11g02460.2	intron_variant ; MODIFIER	silent_mutation	Average:29.716; most accessible tissue: Callus, score: 44.955	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1100738560	NA	1.22E-11	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100738560	NA	3.68E-10	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100738560	NA	1.22E-11	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100738560	NA	4.41E-08	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100738560	NA	2.93E-47	mr1558	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100738560	NA	1.21E-12	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100738560	6.98E-07	1.88E-15	mr1033_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100738560	NA	2.93E-13	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100738560	NA	3.73E-14	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100738560	NA	2.47E-14	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100738560	NA	5.84E-15	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100738560	NA	1.04E-15	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100738560	NA	1.10E-09	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100738560	NA	2.51E-14	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100738560	NA	1.43E-44	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100738560	NA	8.12E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100738560	NA	7.23E-10	mr1993_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251