Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100721323:

Variant ID: vg1100721323 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 721323
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTTTTATTGTTACATATAAGAAATTTAAACACAACCTACGTATTTACATATTTATTACATGCACTACTTAATTTTTAAATAAAAGAAACGGTCAACAC[A/T]
TAACGTTTAAAAGTAAACCATGTCATGAGTAAAAAAATAGAGAGAGTAGTACTAGTAAATTAATTTTGCTAGGCACATACTCCCTCCGTCCCACAAAGAG

Reverse complement sequence

CTCTTTGTGGGACGGAGGGAGTATGTGCCTAGCAAAATTAATTTACTAGTACTACTCTCTCTATTTTTTTACTCATGACATGGTTTACTTTTAAACGTTA[T/A]
GTGTTGACCGTTTCTTTTATTTAAAAATTAAGTAGTGCATGTAATAAATATGTAAATACGTAGGTTGTGTTTAAATTTCTTATATGTAACAATAAAAACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.20%	7.80%	0.97%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	74.10%	22.90%	2.91%	0.00%	NA
Aus	269	98.90%	0.40%	0.74%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	92.40%	5.10%	2.48%	0.00%	NA
Tropical Japonica	504	59.90%	37.50%	2.58%	0.00%	NA
Japonica Intermediate	241	45.60%	49.40%	4.98%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1100721323	A -> T	LOC_Os11g02424.1	upstream_gene_variant ; 1607.0bp to feature; MODIFIER	silent_mutation	Average:53.584; most accessible tissue: Callus, score: 90.105	N	N	N	N
vg1100721323	A -> T	LOC_Os11g02424.2	upstream_gene_variant ; 1607.0bp to feature; MODIFIER	silent_mutation	Average:53.584; most accessible tissue: Callus, score: 90.105	N	N	N	N
vg1100721323	A -> T	LOC_Os11g02400.1	downstream_gene_variant ; 4781.0bp to feature; MODIFIER	silent_mutation	Average:53.584; most accessible tissue: Callus, score: 90.105	N	N	N	N
vg1100721323	A -> T	LOC_Os11g02400.2	downstream_gene_variant ; 4781.0bp to feature; MODIFIER	silent_mutation	Average:53.584; most accessible tissue: Callus, score: 90.105	N	N	N	N
vg1100721323	A -> T	LOC_Os11g02410.1	intron_variant ; MODIFIER	silent_mutation	Average:53.584; most accessible tissue: Callus, score: 90.105	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1100721323	NA	1.67E-11	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1100721323	5.77E-06	NA	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323	3.16E-06	NA	mr1104	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323	NA	4.83E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323	1.35E-08	NA	mr1107	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323	5.19E-07	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323	4.24E-06	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323	NA	9.13E-07	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323	NA	2.04E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323	1.97E-07	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323	4.97E-07	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323	1.30E-06	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323	9.69E-08	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323	NA	3.19E-06	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323	NA	1.89E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251