\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100721323:

Variant ID: vg1100721323 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 721323
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTTTTATTGTTACATATAAGAAATTTAAACACAACCTACGTATTTACATATTTATTACATGCACTACTTAATTTTTAAATAAAAGAAACGGTCAACAC[A/T]
TAACGTTTAAAAGTAAACCATGTCATGAGTAAAAAAATAGAGAGAGTAGTACTAGTAAATTAATTTTGCTAGGCACATACTCCCTCCGTCCCACAAAGAG

Reverse complement sequence

CTCTTTGTGGGACGGAGGGAGTATGTGCCTAGCAAAATTAATTTACTAGTACTACTCTCTCTATTTTTTTACTCATGACATGGTTTACTTTTAAACGTTA[T/A]
GTGTTGACCGTTTCTTTTATTTAAAAATTAAGTAGTGCATGTAATAAATATGTAAATACGTAGGTTGTGTTTAAATTTCTTATATGTAACAATAAAAACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 7.80% 0.97% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 74.10% 22.90% 2.91% 0.00% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 92.40% 5.10% 2.48% 0.00% NA
Tropical Japonica  504 59.90% 37.50% 2.58% 0.00% NA
Japonica Intermediate  241 45.60% 49.40% 4.98% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100721323 A -> T LOC_Os11g02424.1 upstream_gene_variant ; 1607.0bp to feature; MODIFIER silent_mutation Average:53.584; most accessible tissue: Callus, score: 90.105 N N N N
vg1100721323 A -> T LOC_Os11g02424.2 upstream_gene_variant ; 1607.0bp to feature; MODIFIER silent_mutation Average:53.584; most accessible tissue: Callus, score: 90.105 N N N N
vg1100721323 A -> T LOC_Os11g02400.1 downstream_gene_variant ; 4781.0bp to feature; MODIFIER silent_mutation Average:53.584; most accessible tissue: Callus, score: 90.105 N N N N
vg1100721323 A -> T LOC_Os11g02400.2 downstream_gene_variant ; 4781.0bp to feature; MODIFIER silent_mutation Average:53.584; most accessible tissue: Callus, score: 90.105 N N N N
vg1100721323 A -> T LOC_Os11g02410.1 intron_variant ; MODIFIER silent_mutation Average:53.584; most accessible tissue: Callus, score: 90.105 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100721323 NA 1.67E-11 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1100721323 5.77E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323 3.16E-06 NA mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323 NA 4.83E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323 1.35E-08 NA mr1107 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323 5.19E-07 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323 4.24E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323 NA 9.13E-07 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323 NA 2.04E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323 1.97E-07 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323 4.97E-07 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323 1.30E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323 9.69E-08 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323 NA 3.19E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100721323 NA 1.89E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251