\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100689040:

Variant ID: vg1100689040 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 689040
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAACCAATGCTTGTGAGAGTATATTTTTTTTACATCACGAGGGAAAGGGAGGGAAGAGGGATAGGTGGGCAACTATGAGGCTCAATGTGTTATTTACC[G/A]
CTAAAATAAAACTTATCGCTTTTTTTATTTCTCCCCTTATTTTTCTTATCTACTTGTGTTCTATTCATTGACCTGGGTCCTAGTTGGCTAGCTAGCATTT

Reverse complement sequence

AAATGCTAGCTAGCCAACTAGGACCCAGGTCAATGAATAGAACACAAGTAGATAAGAAAAATAAGGGGAGAAATAAAAAAAGCGATAAGTTTTATTTTAG[C/T]
GGTAAATAACACATTGAGCCTCATAGTTGCCCACCTATCCCTCTTCCCTCCCTTTCCCTCGTGATGTAAAAAAAATATACTCTCACAAGCATTGGTTTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 10.00% 0.32% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 76.50% 22.60% 0.93% 0.00% NA
Aus  269 63.60% 36.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 91.90% 7.30% 0.78% 0.00% NA
Tropical Japonica  504 66.70% 32.70% 0.60% 0.00% NA
Japonica Intermediate  241 47.70% 50.20% 2.07% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100689040 G -> A LOC_Os11g02340.1 upstream_gene_variant ; 4866.0bp to feature; MODIFIER silent_mutation Average:45.036; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N
vg1100689040 G -> A LOC_Os11g02360.1 upstream_gene_variant ; 1561.0bp to feature; MODIFIER silent_mutation Average:45.036; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N
vg1100689040 G -> A LOC_Os11g02369.1 upstream_gene_variant ; 4379.0bp to feature; MODIFIER silent_mutation Average:45.036; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N
vg1100689040 G -> A LOC_Os11g02350.1 downstream_gene_variant ; 3414.0bp to feature; MODIFIER silent_mutation Average:45.036; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N
vg1100689040 G -> A LOC_Os11g02360-LOC_Os11g02369 intergenic_region ; MODIFIER silent_mutation Average:45.036; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100689040 7.65E-10 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040 9.24E-07 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040 1.28E-06 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040 2.41E-06 NA mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040 5.55E-06 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040 4.72E-08 NA mr1104 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040 NA 1.95E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040 NA 3.07E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040 NA 9.47E-06 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040 1.20E-06 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040 NA 1.48E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040 1.35E-07 NA mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040 4.87E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040 5.12E-06 5.12E-06 mr1610_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040 NA 7.23E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251