Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100689040:

Variant ID: vg1100689040 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 689040
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CAAAACCAATGCTTGTGAGAGTATATTTTTTTTACATCACGAGGGAAAGGGAGGGAAGAGGGATAGGTGGGCAACTATGAGGCTCAATGTGTTATTTACC[G/A]
CTAAAATAAAACTTATCGCTTTTTTTATTTCTCCCCTTATTTTTCTTATCTACTTGTGTTCTATTCATTGACCTGGGTCCTAGTTGGCTAGCTAGCATTT

Reverse complement sequence

AAATGCTAGCTAGCCAACTAGGACCCAGGTCAATGAATAGAACACAAGTAGATAAGAAAAATAAGGGGAGAAATAAAAAAAGCGATAAGTTTTATTTTAG[C/T]
GGTAAATAACACATTGAGCCTCATAGTTGCCCACCTATCCCTCTTCCCTCCCTTTCCCTCGTGATGTAAAAAAAATATACTCTCACAAGCATTGGTTTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.70%	10.00%	0.32%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	76.50%	22.60%	0.93%	0.00%	NA
Aus	269	63.60%	36.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	91.90%	7.30%	0.78%	0.00%	NA
Tropical Japonica	504	66.70%	32.70%	0.60%	0.00%	NA
Japonica Intermediate	241	47.70%	50.20%	2.07%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	81.10%	17.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1100689040	G -> A	LOC_Os11g02340.1	upstream_gene_variant ; 4866.0bp to feature; MODIFIER	silent_mutation	Average:45.036; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N
vg1100689040	G -> A	LOC_Os11g02360.1	upstream_gene_variant ; 1561.0bp to feature; MODIFIER	silent_mutation	Average:45.036; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N
vg1100689040	G -> A	LOC_Os11g02369.1	upstream_gene_variant ; 4379.0bp to feature; MODIFIER	silent_mutation	Average:45.036; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N
vg1100689040	G -> A	LOC_Os11g02350.1	downstream_gene_variant ; 3414.0bp to feature; MODIFIER	silent_mutation	Average:45.036; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N
vg1100689040	G -> A	LOC_Os11g02360-LOC_Os11g02369	intergenic_region ; MODIFIER	silent_mutation	Average:45.036; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1100689040	7.65E-10	NA	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040	9.24E-07	NA	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040	1.28E-06	NA	mr1085	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040	2.41E-06	NA	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040	5.55E-06	NA	mr1103	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040	4.72E-08	NA	mr1104	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040	NA	1.95E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040	NA	3.07E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040	NA	9.47E-06	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040	1.20E-06	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040	NA	1.48E-06	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040	1.35E-07	NA	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040	4.87E-06	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040	5.12E-06	5.12E-06	mr1610_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100689040	NA	7.23E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251