Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100676096:

Variant ID: vg1100676096 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 676096
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTATTGCTCCTCTCAAATATACAAAATAATAAATATCTAAAATTAGCTTGACTTAAGCCATCCATTCCGCTTGATGTGGTCCTACAAAACAACCAAAAT[G/A]
TATATTGTCACTGTAGTTATTTGTATTTACACAAAAAAAGAATATTGGTCATTTCATACTTGAAGATAAACTTCTGTGATAAGCAAGGTGGACTTGCTTG

Reverse complement sequence

CAAGCAAGTCCACCTTGCTTATCACAGAAGTTTATCTTCAAGTATGAAATGACCAATATTCTTTTTTTGTGTAAATACAAATAACTACAGTGACAATATA[C/T]
ATTTTGGTTGTTTTGTAGGACCACATCAAGCGGAATGGATGGCTTAAGTCAAGCTAATTTTAGATATTTATTATTTTGTATATTTGAGAGGAGCAATACC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.90%	9.90%	0.25%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	77.10%	22.20%	0.73%	0.00%	NA
Aus	269	63.90%	36.10%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	92.80%	6.60%	0.52%	0.00%	NA
Tropical Japonica	504	66.90%	32.90%	0.20%	0.00%	NA
Japonica Intermediate	241	48.10%	49.40%	2.49%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	80.00%	18.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1100676096	G -> A	LOC_Os11g02320.1	upstream_gene_variant ; 4395.0bp to feature; MODIFIER	silent_mutation	Average:40.86; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg1100676096	G -> A	LOC_Os11g02330.1	upstream_gene_variant ; 3938.0bp to feature; MODIFIER	silent_mutation	Average:40.86; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg1100676096	G -> A	LOC_Os11g02320.2	upstream_gene_variant ; 4395.0bp to feature; MODIFIER	silent_mutation	Average:40.86; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg1100676096	G -> A	LOC_Os11g02320.3	upstream_gene_variant ; 4395.0bp to feature; MODIFIER	silent_mutation	Average:40.86; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg1100676096	G -> A	LOC_Os11g02330.2	upstream_gene_variant ; 3938.0bp to feature; MODIFIER	silent_mutation	Average:40.86; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg1100676096	G -> A	LOC_Os11g02310.1	downstream_gene_variant ; 524.0bp to feature; MODIFIER	silent_mutation	Average:40.86; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg1100676096	G -> A	LOC_Os11g02310-LOC_Os11g02330	intergenic_region ; MODIFIER	silent_mutation	Average:40.86; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1100676096	6.44E-10	NA	mr1076	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096	1.38E-07	NA	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096	4.20E-07	NA	mr1085	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096	2.48E-06	NA	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096	2.96E-06	NA	mr1103	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096	4.69E-07	NA	mr1104	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096	NA	2.97E-06	mr1155	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096	NA	6.21E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096	1.14E-06	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096	NA	2.36E-06	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096	5.20E-08	NA	mr1408	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096	1.97E-06	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096	7.92E-06	NA	mr1436	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096	2.70E-06	NA	mr1560	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096	3.70E-06	NA	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251