\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100676096:

Variant ID: vg1100676096 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 676096
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTATTGCTCCTCTCAAATATACAAAATAATAAATATCTAAAATTAGCTTGACTTAAGCCATCCATTCCGCTTGATGTGGTCCTACAAAACAACCAAAAT[G/A]
TATATTGTCACTGTAGTTATTTGTATTTACACAAAAAAAGAATATTGGTCATTTCATACTTGAAGATAAACTTCTGTGATAAGCAAGGTGGACTTGCTTG

Reverse complement sequence

CAAGCAAGTCCACCTTGCTTATCACAGAAGTTTATCTTCAAGTATGAAATGACCAATATTCTTTTTTTGTGTAAATACAAATAACTACAGTGACAATATA[C/T]
ATTTTGGTTGTTTTGTAGGACCACATCAAGCGGAATGGATGGCTTAAGTCAAGCTAATTTTAGATATTTATTATTTTGTATATTTGAGAGGAGCAATACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 9.90% 0.25% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 77.10% 22.20% 0.73% 0.00% NA
Aus  269 63.90% 36.10% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 92.80% 6.60% 0.52% 0.00% NA
Tropical Japonica  504 66.90% 32.90% 0.20% 0.00% NA
Japonica Intermediate  241 48.10% 49.40% 2.49% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100676096 G -> A LOC_Os11g02320.1 upstream_gene_variant ; 4395.0bp to feature; MODIFIER silent_mutation Average:40.86; most accessible tissue: Minghui63 root, score: 61.65 N N N N
vg1100676096 G -> A LOC_Os11g02330.1 upstream_gene_variant ; 3938.0bp to feature; MODIFIER silent_mutation Average:40.86; most accessible tissue: Minghui63 root, score: 61.65 N N N N
vg1100676096 G -> A LOC_Os11g02320.2 upstream_gene_variant ; 4395.0bp to feature; MODIFIER silent_mutation Average:40.86; most accessible tissue: Minghui63 root, score: 61.65 N N N N
vg1100676096 G -> A LOC_Os11g02320.3 upstream_gene_variant ; 4395.0bp to feature; MODIFIER silent_mutation Average:40.86; most accessible tissue: Minghui63 root, score: 61.65 N N N N
vg1100676096 G -> A LOC_Os11g02330.2 upstream_gene_variant ; 3938.0bp to feature; MODIFIER silent_mutation Average:40.86; most accessible tissue: Minghui63 root, score: 61.65 N N N N
vg1100676096 G -> A LOC_Os11g02310.1 downstream_gene_variant ; 524.0bp to feature; MODIFIER silent_mutation Average:40.86; most accessible tissue: Minghui63 root, score: 61.65 N N N N
vg1100676096 G -> A LOC_Os11g02310-LOC_Os11g02330 intergenic_region ; MODIFIER silent_mutation Average:40.86; most accessible tissue: Minghui63 root, score: 61.65 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100676096 6.44E-10 NA mr1076 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096 1.38E-07 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096 4.20E-07 NA mr1085 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096 2.48E-06 NA mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096 2.96E-06 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096 4.69E-07 NA mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096 NA 2.97E-06 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096 NA 6.21E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096 1.14E-06 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096 NA 2.36E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096 5.20E-08 NA mr1408 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096 1.97E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096 7.92E-06 NA mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096 2.70E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100676096 3.70E-06 NA mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251