\
| Variant ID: vg1100676096 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 676096 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGTATTGCTCCTCTCAAATATACAAAATAATAAATATCTAAAATTAGCTTGACTTAAGCCATCCATTCCGCTTGATGTGGTCCTACAAAACAACCAAAAT[G/A]
TATATTGTCACTGTAGTTATTTGTATTTACACAAAAAAAGAATATTGGTCATTTCATACTTGAAGATAAACTTCTGTGATAAGCAAGGTGGACTTGCTTG
CAAGCAAGTCCACCTTGCTTATCACAGAAGTTTATCTTCAAGTATGAAATGACCAATATTCTTTTTTTGTGTAAATACAAATAACTACAGTGACAATATA[C/T]
ATTTTGGTTGTTTTGTAGGACCACATCAAGCGGAATGGATGGCTTAAGTCAAGCTAATTTTAGATATTTATTATTTTGTATATTTGAGAGGAGCAATACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.90% | 9.90% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 77.10% | 22.20% | 0.73% | 0.00% | NA |
| Aus | 269 | 63.90% | 36.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.80% | 6.60% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 66.90% | 32.90% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 48.10% | 49.40% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 18.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1100676096 | G -> A | LOC_Os11g02320.1 | upstream_gene_variant ; 4395.0bp to feature; MODIFIER | silent_mutation | Average:40.86; most accessible tissue: Minghui63 root, score: 61.65 | N | N | N | N |
| vg1100676096 | G -> A | LOC_Os11g02330.1 | upstream_gene_variant ; 3938.0bp to feature; MODIFIER | silent_mutation | Average:40.86; most accessible tissue: Minghui63 root, score: 61.65 | N | N | N | N |
| vg1100676096 | G -> A | LOC_Os11g02320.2 | upstream_gene_variant ; 4395.0bp to feature; MODIFIER | silent_mutation | Average:40.86; most accessible tissue: Minghui63 root, score: 61.65 | N | N | N | N |
| vg1100676096 | G -> A | LOC_Os11g02320.3 | upstream_gene_variant ; 4395.0bp to feature; MODIFIER | silent_mutation | Average:40.86; most accessible tissue: Minghui63 root, score: 61.65 | N | N | N | N |
| vg1100676096 | G -> A | LOC_Os11g02330.2 | upstream_gene_variant ; 3938.0bp to feature; MODIFIER | silent_mutation | Average:40.86; most accessible tissue: Minghui63 root, score: 61.65 | N | N | N | N |
| vg1100676096 | G -> A | LOC_Os11g02310.1 | downstream_gene_variant ; 524.0bp to feature; MODIFIER | silent_mutation | Average:40.86; most accessible tissue: Minghui63 root, score: 61.65 | N | N | N | N |
| vg1100676096 | G -> A | LOC_Os11g02310-LOC_Os11g02330 | intergenic_region ; MODIFIER | silent_mutation | Average:40.86; most accessible tissue: Minghui63 root, score: 61.65 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1100676096 | 6.44E-10 | NA | mr1076 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100676096 | 1.38E-07 | NA | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100676096 | 4.20E-07 | NA | mr1085 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100676096 | 2.48E-06 | NA | mr1086 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100676096 | 2.96E-06 | NA | mr1103 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100676096 | 4.69E-07 | NA | mr1104 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100676096 | NA | 2.97E-06 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100676096 | NA | 6.21E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100676096 | 1.14E-06 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100676096 | NA | 2.36E-06 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100676096 | 5.20E-08 | NA | mr1408 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100676096 | 1.97E-06 | NA | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100676096 | 7.92E-06 | NA | mr1436 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100676096 | 2.70E-06 | NA | mr1560 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100676096 | 3.70E-06 | NA | mr1949 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |