Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100663631:

Variant ID: vg1100663631 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 663631
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


TAATTAATTTTTTCGGCTAATCATCCAATCAAAAACTCCAAACATGTCCTTGAGTACTGCCCTGCTTTGACAGTCTTATCTTTTATCAAGATGGGGTTCA[G/T]
GATTCGTCTAATTGTATTTCCATCGAGAGTTTGAAGTTTCCCATCTTGAAAGCGACATGACTTCAACTTTAGTCTGCTTTACTACCTAAGCTCTTGAAAA

Reverse complement sequence

TTTTCAAGAGCTTAGGTAGTAAAGCAGACTAAAGTTGAAGTCATGTCGCTTTCAAGATGGGAAACTTCAAACTCTCGATGGAAATACAATTAGACGAATC[C/A]
TGAACCCCATCTTGATAAAAGATAAGACTGTCAAAGCAGGGCAGTACTCAAGGACATGTTTGGAGTTTTTGATTGGATGATTAGCCGAAAAAATTAATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 5.40% 0.17% 0.00% NA
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 84.50% 15.00% 0.53% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 2.00% 0.00% 0.00% NA
Temperate Japonica  767 99.30% 0.50% 0.13% 0.00% NA
Tropical Japonica  504 55.00% 43.70% 1.39% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100663631 G -> T LOC_Os11g02300.1 upstream_gene_variant ; 2395.0bp to feature; MODIFIER silent_mutation Average:78.554; most accessible tissue: Zhenshan97 root, score: 95.919 N N N N
vg1100663631 G -> T LOC_Os11g02305.1 upstream_gene_variant ; 3446.0bp to feature; MODIFIER silent_mutation Average:78.554; most accessible tissue: Zhenshan97 root, score: 95.919 N N N N
vg1100663631 G -> T LOC_Os11g02300.2 upstream_gene_variant ; 2395.0bp to feature; MODIFIER silent_mutation Average:78.554; most accessible tissue: Zhenshan97 root, score: 95.919 N N N N
vg1100663631 G -> T LOC_Os11g02320.1 downstream_gene_variant ; 344.0bp to feature; MODIFIER silent_mutation Average:78.554; most accessible tissue: Zhenshan97 root, score: 95.919 N N N N
vg1100663631 G -> T LOC_Os11g02320.2 downstream_gene_variant ; 344.0bp to feature; MODIFIER silent_mutation Average:78.554; most accessible tissue: Zhenshan97 root, score: 95.919 N N N N
vg1100663631 G -> T LOC_Os11g02320.3 downstream_gene_variant ; 344.0bp to feature; MODIFIER silent_mutation Average:78.554; most accessible tissue: Zhenshan97 root, score: 95.919 N N N N
vg1100663631 G -> T LOC_Os11g02300-LOC_Os11g02320 intergenic_region ; MODIFIER silent_mutation Average:78.554; most accessible tissue: Zhenshan97 root, score: 95.919 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1100663631 G T -0.12 -0.09 -0.09 -0.04 -0.04 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100663631 4.58E-08 7.91E-10 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 NA 7.01E-09 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 6.48E-08 7.89E-11 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 3.99E-07 4.00E-07 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 NA 4.33E-06 mr1107 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 6.90E-06 6.90E-06 mr1204 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 3.82E-07 1.73E-09 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 9.21E-07 9.21E-07 mr1264 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 7.68E-07 7.75E-09 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 5.07E-07 3.36E-07 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 NA 8.27E-07 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 NA 1.71E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 4.54E-07 4.54E-07 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 NA 1.37E-07 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 NA 4.62E-08 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 5.83E-06 1.86E-06 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 2.18E-06 1.49E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 NA 1.26E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 4.17E-06 NA mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 2.13E-06 2.42E-09 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100663631 NA 4.28E-06 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251