Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100598516:

Variant ID: vg1100598516 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 598516
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

GAGCACTCTGGGGATACATTTAGATGTTAAATTATATTGCAGTTTTCTATTTGAGCATGCATGCGTATCCCCAGAGTGCTTATCTAAATTGCATGCGTAT[C/A]
TAAATTATATTGTTGGGGATACATTTTTGTCAATTAGAAAGCTCAGCTTCATTTCTAACATCTATTTGAGCATGCATGCGTATCCCCAGAGTGCTTATAT

Reverse complement sequence

ATATAAGCACTCTGGGGATACGCATGCATGCTCAAATAGATGTTAGAAATGAAGCTGAGCTTTCTAATTGACAAAAATGTATCCCCAACAATATAATTTA[G/T]
ATACGCATGCAATTTAGATAAGCACTCTGGGGATACGCATGCATGCTCAAATAGAAAACTGCAATATAATTTAACATCTAAATGTATCCCCAGAGTGCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.20%	4.20%	1.65%	0.00%	NA
All Indica	2759	99.10%	0.10%	0.87%	0.00%	NA
All Japonica	1512	83.90%	12.60%	3.44%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	97.80%	0.00%	2.18%	0.00%	NA
Indica II	465	98.70%	0.20%	1.08%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.00%	0.76%	0.00%	NA
Temperate Japonica	767	93.60%	3.70%	2.74%	0.00%	NA
Tropical Japonica	504	76.60%	20.80%	2.58%	0.00%	NA
Japonica Intermediate	241	68.50%	24.10%	7.47%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1100598516	C -> A	LOC_Os11g02165.1	upstream_gene_variant ; 2754.0bp to feature; MODIFIER	silent_mutation	Average:41.431; most accessible tissue: Zhenshan97 flower, score: 62.374	N	N	N	N
vg1100598516	C -> A	LOC_Os11g02150.1	downstream_gene_variant ; 3666.0bp to feature; MODIFIER	silent_mutation	Average:41.431; most accessible tissue: Zhenshan97 flower, score: 62.374	N	N	N	N
vg1100598516	C -> A	LOC_Os11g02180.1	downstream_gene_variant ; 3751.0bp to feature; MODIFIER	silent_mutation	Average:41.431; most accessible tissue: Zhenshan97 flower, score: 62.374	N	N	N	N
vg1100598516	C -> A	LOC_Os11g02150.2	downstream_gene_variant ; 3666.0bp to feature; MODIFIER	silent_mutation	Average:41.431; most accessible tissue: Zhenshan97 flower, score: 62.374	N	N	N	N
vg1100598516	C -> A	LOC_Os11g02159.1	intron_variant ; MODIFIER	silent_mutation	Average:41.431; most accessible tissue: Zhenshan97 flower, score: 62.374	N	N	N	N
vg1100598516	C -> A	LOC_Os11g02159.2	intron_variant ; MODIFIER	silent_mutation	Average:41.431; most accessible tissue: Zhenshan97 flower, score: 62.374	N	N	N	N
vg1100598516	C -> A	LOC_Os11g02159.3	intron_variant ; MODIFIER	silent_mutation	Average:41.431; most accessible tissue: Zhenshan97 flower, score: 62.374	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1100598516	NA	2.00E-12	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1100598516	NA	2.70E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516	6.00E-06	NA	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516	4.66E-06	NA	mr1104	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516	NA	4.32E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516	1.82E-06	NA	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516	NA	8.79E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516	NA	9.25E-07	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516	9.46E-06	9.41E-06	mr1258	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516	3.85E-06	NA	mr1264	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516	1.91E-06	NA	mr1437	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516	NA	2.44E-06	mr1437	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516	8.51E-06	8.51E-06	mr1663	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516	NA	1.96E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516	6.81E-06	2.28E-11	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516	NA	1.03E-06	mr1751	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516	NA	5.99E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516	NA	2.96E-06	mr1906	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516	NA	6.43E-06	mr1960	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251