\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100598516:

Variant ID: vg1100598516 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 598516
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCACTCTGGGGATACATTTAGATGTTAAATTATATTGCAGTTTTCTATTTGAGCATGCATGCGTATCCCCAGAGTGCTTATCTAAATTGCATGCGTAT[C/A]
TAAATTATATTGTTGGGGATACATTTTTGTCAATTAGAAAGCTCAGCTTCATTTCTAACATCTATTTGAGCATGCATGCGTATCCCCAGAGTGCTTATAT

Reverse complement sequence

ATATAAGCACTCTGGGGATACGCATGCATGCTCAAATAGATGTTAGAAATGAAGCTGAGCTTTCTAATTGACAAAAATGTATCCCCAACAATATAATTTA[G/T]
ATACGCATGCAATTTAGATAAGCACTCTGGGGATACGCATGCATGCTCAAATAGAAAACTGCAATATAATTTAACATCTAAATGTATCCCCAGAGTGCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.20% 4.20% 1.65% 0.00% NA
All Indica  2759 99.10% 0.10% 0.87% 0.00% NA
All Japonica  1512 83.90% 12.60% 3.44% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 97.80% 0.00% 2.18% 0.00% NA
Indica II  465 98.70% 0.20% 1.08% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.00% 0.76% 0.00% NA
Temperate Japonica  767 93.60% 3.70% 2.74% 0.00% NA
Tropical Japonica  504 76.60% 20.80% 2.58% 0.00% NA
Japonica Intermediate  241 68.50% 24.10% 7.47% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100598516 C -> A LOC_Os11g02165.1 upstream_gene_variant ; 2754.0bp to feature; MODIFIER silent_mutation Average:41.431; most accessible tissue: Zhenshan97 flower, score: 62.374 N N N N
vg1100598516 C -> A LOC_Os11g02150.1 downstream_gene_variant ; 3666.0bp to feature; MODIFIER silent_mutation Average:41.431; most accessible tissue: Zhenshan97 flower, score: 62.374 N N N N
vg1100598516 C -> A LOC_Os11g02180.1 downstream_gene_variant ; 3751.0bp to feature; MODIFIER silent_mutation Average:41.431; most accessible tissue: Zhenshan97 flower, score: 62.374 N N N N
vg1100598516 C -> A LOC_Os11g02150.2 downstream_gene_variant ; 3666.0bp to feature; MODIFIER silent_mutation Average:41.431; most accessible tissue: Zhenshan97 flower, score: 62.374 N N N N
vg1100598516 C -> A LOC_Os11g02159.1 intron_variant ; MODIFIER silent_mutation Average:41.431; most accessible tissue: Zhenshan97 flower, score: 62.374 N N N N
vg1100598516 C -> A LOC_Os11g02159.2 intron_variant ; MODIFIER silent_mutation Average:41.431; most accessible tissue: Zhenshan97 flower, score: 62.374 N N N N
vg1100598516 C -> A LOC_Os11g02159.3 intron_variant ; MODIFIER silent_mutation Average:41.431; most accessible tissue: Zhenshan97 flower, score: 62.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100598516 NA 2.00E-12 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1100598516 NA 2.70E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516 6.00E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516 4.66E-06 NA mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516 NA 4.32E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516 1.82E-06 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516 NA 8.79E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516 NA 9.25E-07 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516 9.46E-06 9.41E-06 mr1258 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516 3.85E-06 NA mr1264 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516 1.91E-06 NA mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516 NA 2.44E-06 mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516 8.51E-06 8.51E-06 mr1663 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516 NA 1.96E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516 6.81E-06 2.28E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516 NA 1.03E-06 mr1751 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516 NA 5.99E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516 NA 2.96E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100598516 NA 6.43E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251