\
| Variant ID: vg1100571681 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 571681 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 318. )
CAAGTTTTTCTCACTTCTAAGTATCAAGTACTAACCTTCAGTATTCTGACAATGCAGGGTTGTGATGGATCGGTGCTGCTAGATGACACCCCAACCTTCA[C/T]
TGGAGAGAAGACCGCCGCCCCGAACAACAACTCTCTGCGTGGATTCGATGTTATAGACAACATCAAGGCACAGGTTGAGGGGATCTGTCCGCAGGTGGTG
CACCACCTGCGGACAGATCCCCTCAACCTGTGCCTTGATGTTGTCTATAACATCGAATCCACGCAGAGAGTTGTTGTTCGGGGCGGCGGTCTTCTCTCCA[G/A]
TGAAGGTTGGGGTGTCATCTAGCAGCACCGATCCATCACAACCCTGCATTGTCAGAATACTGAAGGTTAGTACTTGATACTTAGAAGTGAGAAAAACTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.60% | 4.30% | 2.09% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 0.10% | 1.23% | 0.00% | NA |
| All Japonica | 1512 | 83.40% | 12.50% | 4.10% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 96.30% | 0.20% | 3.53% | 0.00% | NA |
| Indica II | 465 | 98.50% | 0.20% | 1.29% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.00% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 92.00% | 4.00% | 3.91% | 0.00% | NA |
| Tropical Japonica | 504 | 77.60% | 19.00% | 3.37% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.00% | 25.70% | 6.22% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1100571681 | C -> T | LOC_Os11g02100.1 | missense_variant ; p.Thr22Ile; MODERATE | nonsynonymous_codon ; T22I | Average:71.639; most accessible tissue: Minghui63 panicle, score: 77.956 | benign |
1.007 |
TOLERATED | 0.09 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1100571681 | NA | 2.54E-14 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1100571681 | NA | 2.11E-06 | Grain_weight | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1100571681 | NA | 1.40E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100571681 | 1.31E-06 | NA | mr1104 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100571681 | NA | 2.63E-06 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100571681 | 3.44E-08 | NA | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100571681 | NA | 2.04E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100571681 | NA | 8.81E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100571681 | NA | 5.40E-07 | mr1224 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100571681 | 1.60E-06 | NA | mr1437 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100571681 | NA | 1.36E-06 | mr1437 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100571681 | 8.18E-06 | 8.17E-06 | mr1663 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100571681 | NA | 1.35E-07 | mr1729 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100571681 | NA | 9.82E-07 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100571681 | 3.85E-06 | 8.77E-12 | mr1751 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100571681 | 7.30E-06 | 3.19E-07 | mr1751 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100571681 | NA | 2.29E-06 | mr1906 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100571681 | NA | 3.13E-06 | mr1906 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100571681 | NA | 5.92E-06 | mr1960 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |