Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100538307:

Variant ID: vg1100538307 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 538307
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGGGGAGAGTTAGCTTTATAGGGATTGGGTATACAAAATCAAGTCAACAACTCTTATTGCCCACTCCACTAGCCTCGGGGGTAGGCCTTGATAGAACC[C/T]
ACGGTGAGCGGAACATGTCGATCGCTCGACACACACACCCGCTCAATCCACTGAGGCCTCGGGGTAGTCCTGAACAGGGCCCATTACATGTGAGGTGCAG

Reverse complement sequence

CTGCACCTCACATGTAATGGGCCCTGTTCAGGACTACCCCGAGGCCTCAGTGGATTGAGCGGGTGTGTGTGTCGAGCGATCGACATGTTCCGCTCACCGT[G/A]
GGTTCTATCAAGGCCTACCCCCGAGGCTAGTGGAGTGGGCAATAAGAGTTGTTGACTTGATTTTGTATACCCAATCCCTATAAAGCTAACTCTCCCCTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 4.00% 0.61% 0.00% NA
All Indica  2759 99.00% 1.00% 0.04% 0.00% NA
All Japonica  1512 88.30% 10.10% 1.65% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 2.00% 0.00% 0.00% NA
Temperate Japonica  767 99.30% 0.40% 0.26% 0.00% NA
Tropical Japonica  504 68.30% 27.40% 4.37% 0.00% NA
Japonica Intermediate  241 95.00% 4.60% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 12.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100538307 C -> T LOC_Os11g02000.1 upstream_gene_variant ; 3033.0bp to feature; MODIFIER silent_mutation Average:97.095; most accessible tissue: Callus, score: 99.939 N N N N
vg1100538307 C -> T LOC_Os11g02020.1 upstream_gene_variant ; 1843.0bp to feature; MODIFIER silent_mutation Average:97.095; most accessible tissue: Callus, score: 99.939 N N N N
vg1100538307 C -> T LOC_Os11g02010.1 intron_variant ; MODIFIER silent_mutation Average:97.095; most accessible tissue: Callus, score: 99.939 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1100538307 C T -0.03 -0.05 -0.02 -0.02 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100538307 NA 1.19E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100538307 7.54E-08 5.64E-09 mr1188 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100538307 NA 1.32E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100538307 NA 1.24E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100538307 NA 7.97E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100538307 NA 1.06E-06 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100538307 NA 1.93E-06 mr1808 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100538307 NA 2.17E-06 mr1133_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100538307 1.54E-06 3.11E-11 mr1188_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100538307 5.40E-06 2.09E-08 mr1217_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100538307 NA 1.48E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100538307 NA 2.18E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100538307 NA 8.92E-08 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100538307 NA 2.31E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100538307 NA 3.02E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251