Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100512559:

Variant ID: vg1100512559 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 512559
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

GCAGAGCGATGTGGCCGTGGCGGGGGGATCCCGGCGAACCGCCACAACCTTGCACGCGATGCGGGGATCCGACCGATAAGTGCTTCGAGTTTTTCCCCTC[G/A]
TCGGAGTTCATTTCTCGCCGCCGCGCCGCCGCGGCCGCATCCCGAAGCCTCCGTCGGTTTCACGGCTGCGAAGGCGAAGCCGTGGAGGGTGGGAGGAGAG

Reverse complement sequence

CTCTCCTCCCACCCTCCACGGCTTCGCCTTCGCAGCCGTGAAACCGACGGAGGCTTCGGGATGCGGCCGCGGCGGCGCGGCGGCGAGAAATGAACTCCGA[C/T]
GAGGGGAAAAACTCGAAGCACTTATCGGTCGGATCCCCGCATCGCGTGCAAGGTTGTGGCGGTTCGCCGGGATCCCCCCGCCACGGCCACATCGCTCTGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.50%	3.70%	3.77%	0.00%	NA
All Indica	2759	88.50%	5.70%	5.76%	0.00%	NA
All Japonica	1512	98.10%	0.90%	0.99%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	88.70%	0.00%	11.26%	0.00%	NA
Indica II	465	63.90%	24.30%	11.83%	0.00%	NA
Indica III	913	99.20%	0.50%	0.22%	0.00%	NA
Indica Intermediate	786	90.50%	5.10%	4.45%	0.00%	NA
Temperate Japonica	767	97.80%	1.20%	1.04%	0.00%	NA
Tropical Japonica	504	99.20%	0.40%	0.40%	0.00%	NA
Japonica Intermediate	241	97.10%	0.80%	2.07%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	4.40%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1100512559	G -> A	LOC_Os11g01950.1	upstream_gene_variant ; 735.0bp to feature; MODIFIER	silent_mutation	Average:72.993; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg1100512559	G -> A	LOC_Os11g01960.1	downstream_gene_variant ; 2426.0bp to feature; MODIFIER	silent_mutation	Average:72.993; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg1100512559	G -> A	LOC_Os11g01930-LOC_Os11g01950	intergenic_region ; MODIFIER	silent_mutation	Average:72.993; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1100512559	NA	8.22E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	NA	6.80E-06	mr1197	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	NA	7.67E-06	mr1216	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	NA	1.78E-06	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	NA	6.70E-07	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	NA	5.00E-06	mr1651	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	1.52E-06	NA	mr1889	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	2.48E-07	1.24E-18	mr1889	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	3.21E-07	NA	mr1896	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	9.83E-08	5.71E-18	mr1896	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	5.54E-06	NA	mr1903	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	NA	2.10E-16	mr1903	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	7.50E-07	NA	mr1907	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	NA	1.75E-21	mr1907	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	1.43E-06	NA	mr1934	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	5.46E-06	2.10E-19	mr1934	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	1.19E-06	NA	mr1935	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	3.20E-06	2.68E-18	mr1935	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	NA	5.14E-06	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	NA	3.41E-07	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	NA	4.26E-07	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	NA	1.07E-15	mr1889_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	NA	1.46E-12	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	NA	1.49E-17	mr1907_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100512559	NA	5.07E-16	mr1934_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251