Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1100433021:

Variant ID: vg1100433021 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 433021
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

TCTTCTATTTCTTCATCTTTCTTTGACTCACCATCATCGACTGCATCTCTGATGGACGGTCCTCCACCTGGTGCCTGCGTCCCCTTCTGTGTCGTCCCTT[G/A]
ACTCTCCTTTATTCCCTCCCGCAGTCATAGCGGGAGTGTCATGGACGATAGCGATGACACGGACGCTTGGACTGGAGTTTCCGTCAATGATTTTTGTTGT

Reverse complement sequence

ACAACAAAAATCATTGACGGAAACTCCAGTCCAAGCGTCCGTGTCATCGCTATCGTCCATGACACTCCCGCTATGACTGCGGGAGGGAATAAAGGAGAGT[C/T]
AAGGGACGACACAGAAGGGGACGCAGGCACCAGGTGGAGGACCGTCCATCAGAGATGCAGTCGATGATGGTGAGTCAAAGAAAGATGAAGAAATAGAAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.50%	5.80%	2.71%	0.00%	NA
All Indica	2759	85.60%	9.90%	4.57%	0.00%	NA
All Japonica	1512	99.80%	0.10%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	60.30%	25.70%	13.95%	0.00%	NA
Indica II	465	90.30%	6.50%	3.23%	0.00%	NA
Indica III	913	98.00%	2.00%	0.00%	0.00%	NA
Indica Intermediate	786	87.40%	9.00%	3.56%	0.00%	NA
Temperate Japonica	767	99.60%	0.30%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1100433021	G -> A	LOC_Os11g01820.1	upstream_gene_variant ; 2141.0bp to feature; MODIFIER	silent_mutation	Average:58.354; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg1100433021	G -> A	LOC_Os11g01810.1	downstream_gene_variant ; 433.0bp to feature; MODIFIER	silent_mutation	Average:58.354; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg1100433021	G -> A	LOC_Os11g01810-LOC_Os11g01820	intergenic_region ; MODIFIER	silent_mutation	Average:58.354; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1100433021	6.72E-08	3.73E-09	mr1038	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100433021	1.13E-06	1.82E-08	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100433021	9.65E-08	1.12E-08	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100433021	1.01E-06	7.09E-08	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100433021	4.89E-08	4.59E-09	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100433021	5.02E-07	4.23E-08	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100433021	1.85E-06	NA	mr1141_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100433021	8.02E-06	NA	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100433021	2.72E-06	5.05E-07	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100433021	9.11E-06	5.03E-07	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251