\
| Variant ID: vg1100433021 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 433021 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 309. )
TCTTCTATTTCTTCATCTTTCTTTGACTCACCATCATCGACTGCATCTCTGATGGACGGTCCTCCACCTGGTGCCTGCGTCCCCTTCTGTGTCGTCCCTT[G/A]
ACTCTCCTTTATTCCCTCCCGCAGTCATAGCGGGAGTGTCATGGACGATAGCGATGACACGGACGCTTGGACTGGAGTTTCCGTCAATGATTTTTGTTGT
ACAACAAAAATCATTGACGGAAACTCCAGTCCAAGCGTCCGTGTCATCGCTATCGTCCATGACACTCCCGCTATGACTGCGGGAGGGAATAAAGGAGAGT[C/T]
AAGGGACGACACAGAAGGGGACGCAGGCACCAGGTGGAGGACCGTCCATCAGAGATGCAGTCGATGATGGTGAGTCAAAGAAAGATGAAGAAATAGAAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 5.80% | 2.71% | 0.00% | NA |
| All Indica | 2759 | 85.60% | 9.90% | 4.57% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 60.30% | 25.70% | 13.95% | 0.00% | NA |
| Indica II | 465 | 90.30% | 6.50% | 3.23% | 0.00% | NA |
| Indica III | 913 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.40% | 9.00% | 3.56% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1100433021 | G -> A | LOC_Os11g01820.1 | upstream_gene_variant ; 2141.0bp to feature; MODIFIER | silent_mutation | Average:58.354; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg1100433021 | G -> A | LOC_Os11g01810.1 | downstream_gene_variant ; 433.0bp to feature; MODIFIER | silent_mutation | Average:58.354; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg1100433021 | G -> A | LOC_Os11g01810-LOC_Os11g01820 | intergenic_region ; MODIFIER | silent_mutation | Average:58.354; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1100433021 | 6.72E-08 | 3.73E-09 | mr1038 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100433021 | 1.13E-06 | 1.82E-08 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100433021 | 9.65E-08 | 1.12E-08 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100433021 | 1.01E-06 | 7.09E-08 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100433021 | 4.89E-08 | 4.59E-09 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100433021 | 5.02E-07 | 4.23E-08 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100433021 | 1.85E-06 | NA | mr1141_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100433021 | 8.02E-06 | NA | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100433021 | 2.72E-06 | 5.05E-07 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100433021 | 9.11E-06 | 5.03E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |