\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100433021:

Variant ID: vg1100433021 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 433021
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTCTATTTCTTCATCTTTCTTTGACTCACCATCATCGACTGCATCTCTGATGGACGGTCCTCCACCTGGTGCCTGCGTCCCCTTCTGTGTCGTCCCTT[G/A]
ACTCTCCTTTATTCCCTCCCGCAGTCATAGCGGGAGTGTCATGGACGATAGCGATGACACGGACGCTTGGACTGGAGTTTCCGTCAATGATTTTTGTTGT

Reverse complement sequence

ACAACAAAAATCATTGACGGAAACTCCAGTCCAAGCGTCCGTGTCATCGCTATCGTCCATGACACTCCCGCTATGACTGCGGGAGGGAATAAAGGAGAGT[C/T]
AAGGGACGACACAGAAGGGGACGCAGGCACCAGGTGGAGGACCGTCCATCAGAGATGCAGTCGATGATGGTGAGTCAAAGAAAGATGAAGAAATAGAAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 5.80% 2.71% 0.00% NA
All Indica  2759 85.60% 9.90% 4.57% 0.00% NA
All Japonica  1512 99.80% 0.10% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 60.30% 25.70% 13.95% 0.00% NA
Indica II  465 90.30% 6.50% 3.23% 0.00% NA
Indica III  913 98.00% 2.00% 0.00% 0.00% NA
Indica Intermediate  786 87.40% 9.00% 3.56% 0.00% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100433021 G -> A LOC_Os11g01820.1 upstream_gene_variant ; 2141.0bp to feature; MODIFIER silent_mutation Average:58.354; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1100433021 G -> A LOC_Os11g01810.1 downstream_gene_variant ; 433.0bp to feature; MODIFIER silent_mutation Average:58.354; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1100433021 G -> A LOC_Os11g01810-LOC_Os11g01820 intergenic_region ; MODIFIER silent_mutation Average:58.354; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100433021 6.72E-08 3.73E-09 mr1038 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100433021 1.13E-06 1.82E-08 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100433021 9.65E-08 1.12E-08 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100433021 1.01E-06 7.09E-08 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100433021 4.89E-08 4.59E-09 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100433021 5.02E-07 4.23E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100433021 1.85E-06 NA mr1141_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100433021 8.02E-06 NA mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100433021 2.72E-06 5.05E-07 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100433021 9.11E-06 5.03E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251