\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100407637:

Variant ID: vg1100407637 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 407637
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


ACCGCGGCCTCGCCTCCTTGCTATTGAGCAATGCAGGAACAACTAATAATAATGCTTCATCTAGTGTGTATATATGTAGCCAATCGATTTATATGGATTC[C/G]
TTAGTTTGGTTTTTACCGTTATTTTTCAGGAGATCGGTTTTTTTCTTGTAAGAGATCGGTTTCTGCAATCAACCGATCCATCAGGAAAAATGTTAAAAAA

Reverse complement sequence

TTTTTTAACATTTTTCCTGATGGATCGGTTGATTGCAGAAACCGATCTCTTACAAGAAAAAAACCGATCTCCTGAAAAATAACGGTAAAAACCAAACTAA[G/C]
GAATCCATATAAATCGATTGGCTACATATATACACACTAGATGAAGCATTATTATTAGTTGTTCCTGCATTGCTCAATAGCAAGGAGGCGAGGCCGCGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.20% 4.50% 0.32% 0.00% NA
All Indica  2759 92.40% 7.10% 0.47% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 98.70% 0.00% 1.34% 0.00% NA
Indica II  465 69.20% 30.80% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 93.50% 5.90% 0.64% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100407637 C -> G LOC_Os11g01750.1 upstream_gene_variant ; 2266.0bp to feature; MODIFIER silent_mutation Average:92.649; most accessible tissue: Zhenshan97 panicle, score: 96.599 N N N N
vg1100407637 C -> G LOC_Os11g01760.1 upstream_gene_variant ; 498.0bp to feature; MODIFIER silent_mutation Average:92.649; most accessible tissue: Zhenshan97 panicle, score: 96.599 N N N N
vg1100407637 C -> G LOC_Os11g01770.1 downstream_gene_variant ; 3440.0bp to feature; MODIFIER silent_mutation Average:92.649; most accessible tissue: Zhenshan97 panicle, score: 96.599 N N N N
vg1100407637 C -> G LOC_Os11g01750-LOC_Os11g01760 intergenic_region ; MODIFIER silent_mutation Average:92.649; most accessible tissue: Zhenshan97 panicle, score: 96.599 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1100407637 C G 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100407637 NA 9.47E-14 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100407637 NA 3.09E-13 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100407637 NA 3.96E-14 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100407637 NA 5.55E-17 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100407637 NA 6.16E-16 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100407637 NA 1.15E-14 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100407637 NA 6.60E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100407637 NA 1.43E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100407637 NA 9.12E-06 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100407637 NA 3.83E-07 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100407637 NA 5.68E-11 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100407637 1.22E-06 NA mr1889_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100407637 3.43E-06 9.29E-19 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100407637 NA 6.66E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100407637 NA 3.38E-12 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100407637 NA 2.08E-16 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100407637 NA 6.44E-14 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251