\
| Variant ID: vg1100364259 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 364259 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATACACAAGTAAATAAAAAAGAATTTGCATAAGCTATATATATAAAGAAGCTAACAAAGTAAAAAAAAGAACCTTGTGGCTAGTCTAACATGGGGGCCGG[C/T]
AGATTTGACCAATGCACACTAACCAAAATGGTGGCGCAATCAAATATCATAGGTAGGATGACTTGGCCATGTGCTTTTCCCTTCAAGCCACGGAGCATAC
GTATGCTCCGTGGCTTGAAGGGAAAAGCACATGGCCAAGTCATCCTACCTATGATATTTGATTGCGCCACCATTTTGGTTAGTGTGCATTGGTCAAATCT[G/A]
CCGGCCCCCATGTTAGACTAGCCACAAGGTTCTTTTTTTTACTTTGTTAGCTTCTTTATATATATAGCTTATGCAAATTCTTTTTTATTTACTTGTGTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.20% | 2.30% | 0.42% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 91.70% | 7.00% | 1.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 96.70% | 2.50% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 85.70% | 13.30% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.40% | 8.30% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1100364259 | C -> T | LOC_Os11g01620.1 | downstream_gene_variant ; 1608.0bp to feature; MODIFIER | silent_mutation | Average:46.869; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg1100364259 | C -> T | LOC_Os11g01620.2 | downstream_gene_variant ; 3006.0bp to feature; MODIFIER | silent_mutation | Average:46.869; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg1100364259 | C -> T | LOC_Os11g01630.1 | intron_variant ; MODIFIER | silent_mutation | Average:46.869; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1100364259 | NA | 5.28E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100364259 | NA | 1.80E-06 | mr1086 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100364259 | NA | 1.70E-07 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100364259 | NA | 2.52E-06 | mr1139 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100364259 | NA | 2.89E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100364259 | NA | 1.04E-07 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100364259 | NA | 3.25E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100364259 | NA | 2.30E-06 | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100364259 | NA | 2.01E-07 | mr1437 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100364259 | NA | 1.76E-06 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100364259 | 3.69E-06 | 3.69E-06 | mr1610_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |