\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100364259:

Variant ID: vg1100364259 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 364259
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATACACAAGTAAATAAAAAAGAATTTGCATAAGCTATATATATAAAGAAGCTAACAAAGTAAAAAAAAGAACCTTGTGGCTAGTCTAACATGGGGGCCGG[C/T]
AGATTTGACCAATGCACACTAACCAAAATGGTGGCGCAATCAAATATCATAGGTAGGATGACTTGGCCATGTGCTTTTCCCTTCAAGCCACGGAGCATAC

Reverse complement sequence

GTATGCTCCGTGGCTTGAAGGGAAAAGCACATGGCCAAGTCATCCTACCTATGATATTTGATTGCGCCACCATTTTGGTTAGTGTGCATTGGTCAAATCT[G/A]
CCGGCCCCCATGTTAGACTAGCCACAAGGTTCTTTTTTTTACTTTGTTAGCTTCTTTATATATATAGCTTATGCAAATTCTTTTTTATTTACTTGTGTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.20% 2.30% 0.42% 0.00% NA
All Indica  2759 99.90% 0.10% 0.04% 0.00% NA
All Japonica  1512 91.70% 7.00% 1.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 96.70% 2.50% 0.78% 0.00% NA
Tropical Japonica  504 85.70% 13.30% 0.99% 0.00% NA
Japonica Intermediate  241 88.40% 8.30% 3.32% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100364259 C -> T LOC_Os11g01620.1 downstream_gene_variant ; 1608.0bp to feature; MODIFIER silent_mutation Average:46.869; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1100364259 C -> T LOC_Os11g01620.2 downstream_gene_variant ; 3006.0bp to feature; MODIFIER silent_mutation Average:46.869; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1100364259 C -> T LOC_Os11g01630.1 intron_variant ; MODIFIER silent_mutation Average:46.869; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100364259 NA 5.28E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100364259 NA 1.80E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100364259 NA 1.70E-07 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100364259 NA 2.52E-06 mr1139 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100364259 NA 2.89E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100364259 NA 1.04E-07 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100364259 NA 3.25E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100364259 NA 2.30E-06 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100364259 NA 2.01E-07 mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100364259 NA 1.76E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100364259 3.69E-06 3.69E-06 mr1610_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251