\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100248726:

Variant ID: vg1100248726 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 248726
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.08, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAATGTTTTAGCAAATTAATTATTCTTGTGAATATATTATGTTTCACATGACTTTTTTTAATGTTTCACTAGTTAGGACTAAACGTTTCATGCAGTGA[T/C]
TGTCGATGTTGCAGTCAGTATTATCGAAATGTTGCATCTCTTTGAAACACATTTAATTACATGATGAAACAATTTTAATATAAGGGGTGAAACAACGCTC

Reverse complement sequence

GAGCGTTGTTTCACCCCTTATATTAAAATTGTTTCATCATGTAATTAAATGTGTTTCAAAGAGATGCAACATTTCGATAATACTGACTGCAACATCGACA[A/G]
TCACTGCATGAAACGTTTAGTCCTAACTAGTGAAACATTAAAAAAAGTCATGTGAAACATAATATATTCACAAGAATAATTAATTTGCTAAAACATTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 47.90% 0.06% 0.00% NA
All Indica  2759 85.50% 14.50% 0.04% 0.00% NA
All Japonica  1512 1.40% 98.60% 0.00% 0.00% NA
Aus  269 19.00% 80.70% 0.37% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 54.40% 45.60% 0.00% 0.00% NA
Indica III  913 93.30% 6.70% 0.00% 0.00% NA
Indica Intermediate  786 85.10% 14.80% 0.13% 0.00% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 25.60% 73.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100248726 T -> C LOC_Os11g01390.1 upstream_gene_variant ; 3089.0bp to feature; MODIFIER silent_mutation Average:43.738; most accessible tissue: Callus, score: 66.714 N N N N
vg1100248726 T -> C LOC_Os11g01380.1 downstream_gene_variant ; 4264.0bp to feature; MODIFIER silent_mutation Average:43.738; most accessible tissue: Callus, score: 66.714 N N N N
vg1100248726 T -> C LOC_Os11g01410.1 downstream_gene_variant ; 2080.0bp to feature; MODIFIER silent_mutation Average:43.738; most accessible tissue: Callus, score: 66.714 N N N N
vg1100248726 T -> C LOC_Os11g01420.1 downstream_gene_variant ; 3700.0bp to feature; MODIFIER silent_mutation Average:43.738; most accessible tissue: Callus, score: 66.714 N N N N
vg1100248726 T -> C LOC_Os11g01400.1 intron_variant ; MODIFIER silent_mutation Average:43.738; most accessible tissue: Callus, score: 66.714 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100248726 NA 7.79E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726 NA 7.89E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726 NA 9.84E-19 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726 NA 3.70E-12 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726 NA 2.11E-10 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726 NA 1.89E-08 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726 NA 3.22E-14 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726 NA 1.03E-09 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726 NA 1.19E-08 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726 NA 2.68E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726 6.06E-06 NA mr1889_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726 NA 8.99E-14 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726 NA 6.26E-08 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726 3.44E-06 NA mr1907_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726 NA 3.24E-13 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726 NA 5.61E-10 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251