Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100248726:

Variant ID: vg1100248726 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 248726
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.08, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAATGTTTTAGCAAATTAATTATTCTTGTGAATATATTATGTTTCACATGACTTTTTTTAATGTTTCACTAGTTAGGACTAAACGTTTCATGCAGTGA[T/C]
TGTCGATGTTGCAGTCAGTATTATCGAAATGTTGCATCTCTTTGAAACACATTTAATTACATGATGAAACAATTTTAATATAAGGGGTGAAACAACGCTC

Reverse complement sequence

GAGCGTTGTTTCACCCCTTATATTAAAATTGTTTCATCATGTAATTAAATGTGTTTCAAAGAGATGCAACATTTCGATAATACTGACTGCAACATCGACA[A/G]
TCACTGCATGAAACGTTTAGTCCTAACTAGTGAAACATTAAAAAAAGTCATGTGAAACATAATATATTCACAAGAATAATTAATTTGCTAAAACATTTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.10%	47.90%	0.06%	0.00%	NA
All Indica	2759	85.50%	14.50%	0.04%	0.00%	NA
All Japonica	1512	1.40%	98.60%	0.00%	0.00%	NA
Aus	269	19.00%	80.70%	0.37%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	54.40%	45.60%	0.00%	0.00%	NA
Indica III	913	93.30%	6.70%	0.00%	0.00%	NA
Indica Intermediate	786	85.10%	14.80%	0.13%	0.00%	NA
Temperate Japonica	767	1.20%	98.80%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.60%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	25.60%	73.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1100248726	T -> C	LOC_Os11g01390.1	upstream_gene_variant ; 3089.0bp to feature; MODIFIER	silent_mutation	Average:43.738; most accessible tissue: Callus, score: 66.714	N	N	N	N
vg1100248726	T -> C	LOC_Os11g01380.1	downstream_gene_variant ; 4264.0bp to feature; MODIFIER	silent_mutation	Average:43.738; most accessible tissue: Callus, score: 66.714	N	N	N	N
vg1100248726	T -> C	LOC_Os11g01410.1	downstream_gene_variant ; 2080.0bp to feature; MODIFIER	silent_mutation	Average:43.738; most accessible tissue: Callus, score: 66.714	N	N	N	N
vg1100248726	T -> C	LOC_Os11g01420.1	downstream_gene_variant ; 3700.0bp to feature; MODIFIER	silent_mutation	Average:43.738; most accessible tissue: Callus, score: 66.714	N	N	N	N
vg1100248726	T -> C	LOC_Os11g01400.1	intron_variant ; MODIFIER	silent_mutation	Average:43.738; most accessible tissue: Callus, score: 66.714	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1100248726	NA	7.79E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726	NA	7.89E-06	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726	NA	9.84E-19	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726	NA	3.70E-12	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726	NA	2.11E-10	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726	NA	1.89E-08	mr1903	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726	NA	3.22E-14	mr1907	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726	NA	1.03E-09	mr1934	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726	NA	1.19E-08	mr1935	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726	NA	2.68E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726	6.06E-06	NA	mr1889_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726	NA	8.99E-14	mr1889_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726	NA	6.26E-08	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726	3.44E-06	NA	mr1907_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726	NA	3.24E-13	mr1907_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100248726	NA	5.61E-10	mr1934_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251