\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100109327:

Variant ID: vg1100109327 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 109327
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, G: 0.27, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


ACATATATAAAGATCCCATCTCTTGGAAAAAAAGTTAATTGCACAATGGCTAGGTATATTTACAAAAGTTTCATATTGGATCACTCTTTAGCAAATGTTT[T/G]
TACTTCGGGTTAGGTAATCTTACCTCTAGTGTAATTTAGACTTGTTATCTCCATCTTTTCATCTCTCTCACCTCTGGCTTCCTATATTTGCCACCATCAT

Reverse complement sequence

ATGATGGTGGCAAATATAGGAAGCCAGAGGTGAGAGAGATGAAAAGATGGAGATAACAAGTCTAAATTACACTAGAGGTAAGATTACCTAACCCGAAGTA[A/C]
AAACATTTGCTAAAGAGTGATCCAATATGAAACTTTTGTAAATATACCTAGCCATTGTGCAATTAACTTTTTTTCCAAGAGATGGGATCTTTATATATGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.70% 43.50% 0.44% 0.36% NA
All Indica  2759 86.70% 12.40% 0.47% 0.40% NA
All Japonica  1512 1.50% 97.60% 0.53% 0.33% NA
Aus  269 67.30% 32.70% 0.00% 0.00% NA
Indica I  595 96.80% 1.70% 0.67% 0.84% NA
Indica II  465 54.20% 44.90% 0.43% 0.43% NA
Indica III  913 95.20% 4.50% 0.11% 0.22% NA
Indica Intermediate  786 88.40% 10.60% 0.76% 0.25% NA
Temperate Japonica  767 1.40% 96.90% 1.04% 0.65% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 26.70% 72.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100109327 T -> DEL N N silent_mutation Average:72.381; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N
vg1100109327 T -> G LOC_Os11g01180.1 upstream_gene_variant ; 1117.0bp to feature; MODIFIER silent_mutation Average:72.381; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N
vg1100109327 T -> G LOC_Os11g01180-LOC_Os11g01200 intergenic_region ; MODIFIER silent_mutation Average:72.381; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100109327 NA 7.30E-09 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100109327 NA 2.14E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100109327 NA 2.63E-12 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100109327 NA 3.98E-10 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100109327 NA 1.98E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100109327 4.78E-07 2.21E-14 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100109327 NA 2.80E-09 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100109327 NA 1.63E-12 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100109327 2.28E-07 9.84E-15 mr1907_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100109327 NA 2.41E-11 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251