\
| Variant ID: vg1100109327 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 109327 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, G: 0.27, others allele: 0.00, population size: 209. )
ACATATATAAAGATCCCATCTCTTGGAAAAAAAGTTAATTGCACAATGGCTAGGTATATTTACAAAAGTTTCATATTGGATCACTCTTTAGCAAATGTTT[T/G]
TACTTCGGGTTAGGTAATCTTACCTCTAGTGTAATTTAGACTTGTTATCTCCATCTTTTCATCTCTCTCACCTCTGGCTTCCTATATTTGCCACCATCAT
ATGATGGTGGCAAATATAGGAAGCCAGAGGTGAGAGAGATGAAAAGATGGAGATAACAAGTCTAAATTACACTAGAGGTAAGATTACCTAACCCGAAGTA[A/C]
AAACATTTGCTAAAGAGTGATCCAATATGAAACTTTTGTAAATATACCTAGCCATTGTGCAATTAACTTTTTTTCCAAGAGATGGGATCTTTATATATGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.70% | 43.50% | 0.44% | 0.36% | NA |
| All Indica | 2759 | 86.70% | 12.40% | 0.47% | 0.40% | NA |
| All Japonica | 1512 | 1.50% | 97.60% | 0.53% | 0.33% | NA |
| Aus | 269 | 67.30% | 32.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.80% | 1.70% | 0.67% | 0.84% | NA |
| Indica II | 465 | 54.20% | 44.90% | 0.43% | 0.43% | NA |
| Indica III | 913 | 95.20% | 4.50% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 88.40% | 10.60% | 0.76% | 0.25% | NA |
| Temperate Japonica | 767 | 1.40% | 96.90% | 1.04% | 0.65% | NA |
| Tropical Japonica | 504 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 26.70% | 72.20% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1100109327 | T -> DEL | N | N | silent_mutation | Average:72.381; most accessible tissue: Minghui63 panicle, score: 87.238 | N | N | N | N |
| vg1100109327 | T -> G | LOC_Os11g01180.1 | upstream_gene_variant ; 1117.0bp to feature; MODIFIER | silent_mutation | Average:72.381; most accessible tissue: Minghui63 panicle, score: 87.238 | N | N | N | N |
| vg1100109327 | T -> G | LOC_Os11g01180-LOC_Os11g01200 | intergenic_region ; MODIFIER | silent_mutation | Average:72.381; most accessible tissue: Minghui63 panicle, score: 87.238 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1100109327 | NA | 7.30E-09 | mr1889 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100109327 | NA | 2.14E-10 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100109327 | NA | 2.63E-12 | mr1907 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100109327 | NA | 3.98E-10 | mr1934 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100109327 | NA | 1.98E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100109327 | 4.78E-07 | 2.21E-14 | mr1889_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100109327 | NA | 2.80E-09 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100109327 | NA | 1.63E-12 | mr1904_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100109327 | 2.28E-07 | 9.84E-15 | mr1907_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100109327 | NA | 2.41E-11 | mr1934_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |