\
| Variant ID: vg1100087658 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 87658 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.21, others allele: 0.00, population size: 81. )
AACTGATCGTGCAACAGTTAGGAAGATAAGAGATGCCATAGATAACCAGGCAGAGGTCACAGTTCAGCTCATAAATTATACAAAAAGTGGTAGGCTACTC[G/A]
TCACTTGTCTGCATGTTTTTGTTCTCAACTTATAAATATAATAGGTAGTTGATACCCCGCGCTTTGTTGCGGGATATGTATATGAATACATGCTATACAT
ATGTATAGCATGTATTCATATACATATCCCGCAACAAAGCGCGGGGTATCAACTACCTATTATATTTATAAGTTGAGAACAAAAACATGCAGACAAGTGA[C/T]
GAGTAGCCTACCACTTTTTGTATAATTTATGAGCTGAACTGTGACCTCTGCCTGGTTATCTATGGCATCTCTTATCTTCCTAACTGTTGCACGATCAGTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.90% | 42.70% | 0.08% | 0.34% | NA |
| All Indica | 2759 | 88.40% | 11.50% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 1.60% | 97.40% | 0.07% | 0.99% | NA |
| Aus | 269 | 68.80% | 30.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 55.70% | 44.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.20% | 8.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 1.30% | 96.70% | 0.00% | 1.96% | NA |
| Tropical Japonica | 504 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 32.20% | 66.70% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1100087658 | G -> A | LOC_Os11g01140.1 | intron_variant ; MODIFIER | silent_mutation | Average:13.989; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| vg1100087658 | G -> A | LOC_Os11g01140.2 | intron_variant ; MODIFIER | silent_mutation | Average:13.989; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| vg1100087658 | G -> A | LOC_Os11g01140.3 | intron_variant ; MODIFIER | silent_mutation | Average:13.989; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| vg1100087658 | G -> DEL | N | N | silent_mutation | Average:13.989; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1100087658 | NA | 2.95E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100087658 | NA | 9.48E-10 | mr1889 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100087658 | NA | 6.43E-09 | mr1896 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100087658 | NA | 1.65E-08 | mr1903 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100087658 | NA | 5.74E-11 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100087658 | NA | 1.18E-13 | mr1907 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100087658 | NA | 3.95E-10 | mr1934 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100087658 | NA | 9.38E-09 | mr1935 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100087658 | NA | 6.79E-11 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100087658 | 2.56E-07 | NA | mr1889_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100087658 | 1.55E-07 | 2.27E-16 | mr1889_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100087658 | NA | 2.52E-09 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100087658 | NA | 4.41E-15 | mr1904_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100087658 | 3.50E-06 | NA | mr1907_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100087658 | NA | 1.76E-14 | mr1907_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100087658 | NA | 3.36E-11 | mr1934_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |