\
| Variant ID: vg1100083618 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 83618 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGTGTTTGGTTAGGGAGAGAGAGAGTGGCGATAATTATAAGGGACAATTGTTTATTTGACTTTGTTTTGAAGCCTAACTACCAATTTGACTCTATTTTTT[C/T]
TAGTTTGCTTATTTGCCTGCTTTTCGAAAATGAACACTCCGTCTGACCTGTTTCTACAACACCGTTAAGAGTTCATTTTAAAAAAGAGGAAAAATAAAAA
TTTTTATTTTTCCTCTTTTTTAAAATGAACTCTTAACGGTGTTGTAGAAACAGGTCAGACGGAGTGTTCATTTTCGAAAAGCAGGCAAATAAGCAAACTA[G/A]
AAAAAATAGAGTCAAATTGGTAGTTAGGCTTCAAAACAAAGTCAAATAAACAATTGTCCCTTATAATTATCGCCACTCTCTCTCTCCCTAACCAAACACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.50% | 2.10% | 4.34% | 0.06% | NA |
| All Indica | 2759 | 89.40% | 3.60% | 7.07% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.10% | 0.53% | 0.20% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.40% | 3.00% | 8.57% | 0.00% | NA |
| Indica II | 465 | 98.10% | 0.20% | 1.72% | 0.00% | NA |
| Indica III | 913 | 86.00% | 4.90% | 9.09% | 0.00% | NA |
| Indica Intermediate | 786 | 88.90% | 4.30% | 6.74% | 0.00% | NA |
| Temperate Japonica | 767 | 98.30% | 0.30% | 1.04% | 0.39% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1100083618 | C -> T | LOC_Os11g01140.1 | intron_variant ; MODIFIER | silent_mutation | Average:27.257; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1100083618 | C -> T | LOC_Os11g01140.2 | intron_variant ; MODIFIER | silent_mutation | Average:27.257; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1100083618 | C -> T | LOC_Os11g01140.3 | intron_variant ; MODIFIER | silent_mutation | Average:27.257; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1100083618 | C -> DEL | N | N | silent_mutation | Average:27.257; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1100083618 | NA | 9.89E-07 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100083618 | NA | 1.31E-08 | mr1291 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100083618 | NA | 5.10E-06 | mr1502 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100083618 | NA | 7.85E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100083618 | NA | 4.90E-06 | mr1892 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100083618 | NA | 1.85E-07 | mr1543_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |