| Variant ID: vg1100066353 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 66353 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.28, others allele: 0.00, population size: 76. )
GTAAAGATCCCACACTGTTTTTCACCCTAGGTTGCCATGTTGGCATGCCATGTGGGCAAAAGTGGTAAATAGTTAAGAAACCACCCCTTTATTAAAGGGG[A/G]
AAAAATAAAAGCAAATCTAACAGGGTAATTTGGATAATTGTCAAACCTAATAGTTACAAATAGTTAACTTAATTTCTCGATGCATCATGTAGACAACATC
GATGTTGTCTACATGATGCATCGAGAAATTAAGTTAACTATTTGTAACTATTAGGTTTGACAATTATCCAAATTACCCTGTTAGATTTGCTTTTATTTTT[T/C]
CCCCTTTAATAAAGGGGTGGTTTCTTAACTATTTACCACTTTTGCCCACATGGCATGCCAACATGGCAACCTAGGGTGAAAAACAGTGTGGGATCTTTAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.10% | 47.40% | 2.43% | 0.04% | NA |
| All Indica | 2759 | 18.80% | 77.80% | 3.41% | 0.00% | NA |
| All Japonica | 1512 | 97.90% | 1.50% | 0.60% | 0.07% | NA |
| Aus | 269 | 82.20% | 15.20% | 2.60% | 0.00% | NA |
| Indica I | 595 | 10.90% | 84.40% | 4.71% | 0.00% | NA |
| Indica II | 465 | 47.10% | 50.10% | 2.80% | 0.00% | NA |
| Indica III | 913 | 8.80% | 89.00% | 2.19% | 0.00% | NA |
| Indica Intermediate | 786 | 19.70% | 76.10% | 4.20% | 0.00% | NA |
| Temperate Japonica | 767 | 97.40% | 1.30% | 1.17% | 0.13% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 12.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 23.30% | 4.44% | 1.11% | NA |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1100066353 | NA | 5.23E-06 | mr1020 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 5.46E-18 | mr1032 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 8.23E-10 | mr1032 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 3.94E-17 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 1.05E-07 | mr1165 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 2.99E-06 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 1.07E-06 | mr1477 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 4.67E-17 | mr1478 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 1.72E-08 | mr1478 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 1.97E-09 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 1.71E-06 | mr1648 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 6.12E-10 | mr1889 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 6.13E-13 | mr1907 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 1.31E-06 | mr1971 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 7.86E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 2.60E-06 | mr1064_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 1.25E-06 | mr1268_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 2.37E-06 | mr1332_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 6.91E-12 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 1.47E-06 | mr1349_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 5.92E-06 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 2.32E-10 | mr1478_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 1.67E-07 | mr1478_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 5.23E-09 | mr1546_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 5.18E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 8.95E-06 | mr1648_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 3.49E-07 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 6.92E-06 | mr1682_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 3.54E-17 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 6.60E-06 | mr1836_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | 4.94E-06 | 1.18E-13 | mr1889_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 1.94E-07 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 1.76E-13 | mr1907_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100066353 | NA | 3.58E-10 | mr1934_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |