\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100024654:

Variant ID: vg1100024654 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 24654
Reference Allele: GAlternative Allele: A,GT
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


CAATCTGAGCGCCCAACTGCCTCCTCGATATCAATATGCTTGGCCCGATGTCGATTTGCATGCCTAGCGTCCTCTCATCACTGGTCTATGCTATGGCAAT[G/A,GT]
TTACAACAGTATGATAAAACCATGGTCGAAACTGTACGGGGATGCAAAGTGAACTGGTTTTAACAATTAAGGAAAGCTTCAGAACCATATATTGATGCCC

Reverse complement sequence

GGGCATCAATATATGGTTCTGAAGCTTTCCTTAATTGTTAAAACCAGTTCACTTTGCATCCCCGTACAGTTTCGACCATGGTTTTATCATACTGTTGTAA[C/T,AC]
ATTGCCATAGCATAGACCAGTGATGAGAGGACGCTAGGCATGCAAATCGACATCGGGCCAAGCATATTGATATCGAGGAGGCAGTTGGGCGCTCAGATTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 13.60% 6.07% 16.36% GT: 0.02%
All Indica  2759 46.90% 15.50% 10.26% 27.29% NA
All Japonica  1512 97.80% 1.10% 0.07% 1.12% NA
Aus  269 35.70% 63.90% 0.37% 0.00% NA
Indica I  595 54.60% 13.40% 8.24% 23.70% NA
Indica II  465 68.80% 3.90% 7.74% 19.57% NA
Indica III  913 30.40% 21.20% 14.57% 33.73% NA
Indica Intermediate  786 47.30% 17.30% 8.27% 27.10% NA
Temperate Japonica  767 97.00% 1.00% 0.00% 1.96% NA
Tropical Japonica  504 98.60% 1.00% 0.20% 0.20% NA
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.41% NA
VI/Aromatic  96 87.50% 11.50% 0.00% 1.04% NA
Intermediate  90 77.80% 16.70% 2.22% 2.22% GT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100024654 G -> A LOC_Os11g01050.1 downstream_gene_variant ; 2374.0bp to feature; MODIFIER silent_mutation Average:33.561; most accessible tissue: Minghui63 root, score: 51.763 N N N N
vg1100024654 G -> A LOC_Os11g01060.1 downstream_gene_variant ; 4972.0bp to feature; MODIFIER silent_mutation Average:33.561; most accessible tissue: Minghui63 root, score: 51.763 N N N N
vg1100024654 G -> A LOC_Os11g01040-LOC_Os11g01050 intergenic_region ; MODIFIER silent_mutation Average:33.561; most accessible tissue: Minghui63 root, score: 51.763 N N N N
vg1100024654 G -> GT LOC_Os11g01050.1 downstream_gene_variant ; 2373.0bp to feature; MODIFIER silent_mutation Average:33.561; most accessible tissue: Minghui63 root, score: 51.763 N N N N
vg1100024654 G -> GT LOC_Os11g01060.1 downstream_gene_variant ; 4971.0bp to feature; MODIFIER silent_mutation Average:33.561; most accessible tissue: Minghui63 root, score: 51.763 N N N N
vg1100024654 G -> GT LOC_Os11g01040-LOC_Os11g01050 intergenic_region ; MODIFIER silent_mutation Average:33.561; most accessible tissue: Minghui63 root, score: 51.763 N N N N
vg1100024654 G -> DEL N N silent_mutation Average:33.561; most accessible tissue: Minghui63 root, score: 51.763 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100024654 1.84E-06 1.84E-06 mr1770 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251