\
| Variant ID: vg1100016479 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16479 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, A: 0.08, others allele: 0.00, population size: 63. )
ATCCGATTTATGATCCGATTACACGCGGTTGTGTTTGTAAGAATTAAATCTTTACAACAAGATCTCACATGATTATATTTTGATGAAAAATTACAAATTA[C/A]
TTTTATAGTATATCTAAATTACTTTTTAGACATATAAAAGTAATTTCAGTAAAACTTAAAAGTAATTTACATATATTATAGAAGTAACTTAAGACAAAAA
TTTTTGTCTTAAGTTACTTCTATAATATATGTAAATTACTTTTAAGTTTTACTGAAATTACTTTTATATGTCTAAAAAGTAATTTAGATATACTATAAAA[G/T]
TAATTTGTAATTTTTCATCAAAATATAATCATGTGAGATCTTGTTGTAAAGATTTAATTCTTACAAACACAACCGCGTGTAATCGGATCATAAATCGGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.60% | 2.90% | 6.37% | 47.12% | NA |
| All Indica | 2759 | 12.60% | 4.90% | 9.82% | 72.67% | NA |
| All Japonica | 1512 | 97.80% | 0.00% | 0.33% | 1.92% | NA |
| Aus | 269 | 32.00% | 0.40% | 6.69% | 60.97% | NA |
| Indica I | 595 | 3.40% | 4.50% | 6.89% | 85.21% | NA |
| Indica II | 465 | 44.50% | 2.40% | 9.03% | 44.09% | NA |
| Indica III | 913 | 4.70% | 6.50% | 10.95% | 77.88% | NA |
| Indica Intermediate | 786 | 9.80% | 5.00% | 11.20% | 74.05% | NA |
| Temperate Japonica | 767 | 97.10% | 0.00% | 0.39% | 2.48% | NA |
| Tropical Japonica | 504 | 98.60% | 0.00% | 0.20% | 1.19% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 0.41% | 1.66% | NA |
| VI/Aromatic | 96 | 87.50% | 0.00% | 3.12% | 9.38% | NA |
| Intermediate | 90 | 73.30% | 0.00% | 4.44% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1100016479 | C -> A | LOC_Os11g01040.1 | upstream_gene_variant ; 683.0bp to feature; MODIFIER | silent_mutation | Average:12.524; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1100016479 | C -> A | LOC_Os11g01040-LOC_Os11g01050 | intergenic_region ; MODIFIER | silent_mutation | Average:12.524; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1100016479 | C -> DEL | N | N | silent_mutation | Average:12.524; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1100016479 | NA | 1.12E-12 | mr1907 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100016479 | NA | 2.52E-09 | mr1934 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100016479 | NA | 2.28E-06 | mr1042_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100016479 | 1.98E-06 | 2.51E-06 | mr1457_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100016479 | NA | 9.62E-11 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100016479 | NA | 4.68E-06 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100016479 | NA | 1.74E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100016479 | 2.05E-07 | 3.50E-15 | mr1889_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100016479 | 7.91E-07 | 1.58E-11 | mr1896_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100016479 | 7.51E-07 | 6.84E-16 | mr1907_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100016479 | 3.31E-06 | 1.64E-12 | mr1934_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |