\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100016479:

Variant ID: vg1100016479 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16479
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, A: 0.08, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCGATTTATGATCCGATTACACGCGGTTGTGTTTGTAAGAATTAAATCTTTACAACAAGATCTCACATGATTATATTTTGATGAAAAATTACAAATTA[C/A]
TTTTATAGTATATCTAAATTACTTTTTAGACATATAAAAGTAATTTCAGTAAAACTTAAAAGTAATTTACATATATTATAGAAGTAACTTAAGACAAAAA

Reverse complement sequence

TTTTTGTCTTAAGTTACTTCTATAATATATGTAAATTACTTTTAAGTTTTACTGAAATTACTTTTATATGTCTAAAAAGTAATTTAGATATACTATAAAA[G/T]
TAATTTGTAATTTTTCATCAAAATATAATCATGTGAGATCTTGTTGTAAAGATTTAATTCTTACAAACACAACCGCGTGTAATCGGATCATAAATCGGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.60% 2.90% 6.37% 47.12% NA
All Indica  2759 12.60% 4.90% 9.82% 72.67% NA
All Japonica  1512 97.80% 0.00% 0.33% 1.92% NA
Aus  269 32.00% 0.40% 6.69% 60.97% NA
Indica I  595 3.40% 4.50% 6.89% 85.21% NA
Indica II  465 44.50% 2.40% 9.03% 44.09% NA
Indica III  913 4.70% 6.50% 10.95% 77.88% NA
Indica Intermediate  786 9.80% 5.00% 11.20% 74.05% NA
Temperate Japonica  767 97.10% 0.00% 0.39% 2.48% NA
Tropical Japonica  504 98.60% 0.00% 0.20% 1.19% NA
Japonica Intermediate  241 97.90% 0.00% 0.41% 1.66% NA
VI/Aromatic  96 87.50% 0.00% 3.12% 9.38% NA
Intermediate  90 73.30% 0.00% 4.44% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100016479 C -> A LOC_Os11g01040.1 upstream_gene_variant ; 683.0bp to feature; MODIFIER silent_mutation Average:12.524; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1100016479 C -> A LOC_Os11g01040-LOC_Os11g01050 intergenic_region ; MODIFIER silent_mutation Average:12.524; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1100016479 C -> DEL N N silent_mutation Average:12.524; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100016479 NA 1.12E-12 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100016479 NA 2.52E-09 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100016479 NA 2.28E-06 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100016479 1.98E-06 2.51E-06 mr1457_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100016479 NA 9.62E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100016479 NA 4.68E-06 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100016479 NA 1.74E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100016479 2.05E-07 3.50E-15 mr1889_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100016479 7.91E-07 1.58E-11 mr1896_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100016479 7.51E-07 6.84E-16 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100016479 3.31E-06 1.64E-12 mr1934_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251