\
| Variant ID: vg1023087868 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 23087868 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.09, others allele: 0.00, population size: 227. )
GCTCAATTTGAAATATAGATTGGATGTGATTTGTATCTCTCAAGTATAAAATCAGGTACAATAACTCCAACTATTAAAATCGGTGCAAAATGACTCCCAG[A/G]
TAGTATTGTTGGTGGTATTTGCTGACATGGTGTCTATATGGCAACCCAATCATTTGAGAAAATTAAAAAAAATATGAAAGAGCCCATATATCATCCTCCC
GGGAGGATGATATATGGGCTCTTTCATATTTTTTTTAATTTTCTCAAATGATTGGGTTGCCATATAGACACCATGTCAGCAAATACCACCAACAATACTA[T/C]
CTGGGAGTCATTTTGCACCGATTTTAATAGTTGGAGTTATTGTACCTGATTTTATACTTGAGAGATACAAATCACATCCAATCTATATTTCAAATTGAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.40% | 38.20% | 0.44% | 0.00% | NA |
| All Indica | 2759 | 94.30% | 5.00% | 0.69% | 0.00% | NA |
| All Japonica | 1512 | 0.80% | 99.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 87.00% | 13.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.40% | 8.90% | 1.68% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.90% | 7.10% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 0.80% | 99.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 53.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1023087868 | A -> G | LOC_Os10g42800.1 | upstream_gene_variant ; 1283.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1023087868 | A -> G | LOC_Os10g42810.1 | downstream_gene_variant ; 363.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1023087868 | A -> G | LOC_Os10g42820.1 | downstream_gene_variant ; 229.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1023087868 | A -> G | LOC_Os10g42820.2 | downstream_gene_variant ; 235.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1023087868 | A -> G | LOC_Os10g42810-LOC_Os10g42820 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1023087868 | NA | 8.78E-10 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | NA | 3.98E-13 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | NA | 4.16E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | NA | 3.11E-11 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | NA | 1.28E-06 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | NA | 2.30E-06 | mr1156_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | NA | 7.57E-06 | mr1159_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | 4.51E-06 | 4.51E-06 | mr1284_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | NA | 3.86E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | NA | 1.96E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | NA | 5.11E-07 | mr1349_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | NA | 2.40E-06 | mr1622_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | NA | 1.78E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | NA | 6.52E-06 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | NA | 7.81E-06 | mr1655_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | NA | 3.15E-06 | mr1669_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | NA | 6.68E-07 | mr1682_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | NA | 4.62E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | NA | 1.31E-07 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | NA | 4.87E-06 | mr1974_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023087868 | 5.38E-06 | 5.19E-07 | mr1974_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |