\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1023072667:

Variant ID: vg1023072667 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 23072667
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTGGACACATGGTGGGCCAAGGGGAGTGCACGCGCACGCGCCCCTAGCATGCGCGCGTGCGCGGGGGTGGGGGGAGCGCCCGATTTCTGCACACACAC[A/C]
CCCCCTCCACCCGTCGCCCGGCGATAATCATTATCGCAATTTAATACCTGCCGTGTGCAAATCATCAGGATCACGCCAACATAAGCGCCAACCATTTCAA

Reverse complement sequence

TTGAAATGGTTGGCGCTTATGTTGGCGTGATCCTGATGATTTGCACACGGCAGGTATTAAATTGCGATAATGATTATCGCCGGGCGACGGGTGGAGGGGG[T/G]
GTGTGTGTGCAGAAATCGGGCGCTCCCCCCACCCCCGCGCACGCGCGCATGCTAGGGGCGCGTGCGCGTGCACTCCCCTTGGCCCACCATGTGTCCACAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 14.20% 0.25% 18.07% NA
All Indica  2759 70.00% 0.50% 0.22% 29.29% NA
All Japonica  1512 62.40% 37.00% 0.33% 0.26% NA
Aus  269 87.40% 0.70% 0.37% 11.52% NA
Indica I  595 70.80% 0.00% 0.34% 28.91% NA
Indica II  465 92.70% 1.50% 0.22% 5.59% NA
Indica III  913 56.00% 0.40% 0.11% 43.48% NA
Indica Intermediate  786 72.30% 0.40% 0.25% 27.10% NA
Temperate Japonica  767 94.30% 5.20% 0.39% 0.13% NA
Tropical Japonica  504 22.00% 77.20% 0.20% 0.60% NA
Japonica Intermediate  241 45.60% 53.90% 0.41% 0.00% NA
VI/Aromatic  96 25.00% 75.00% 0.00% 0.00% NA
Intermediate  90 60.00% 27.80% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1023072667 A -> C LOC_Os10g42754.1 upstream_gene_variant ; 2913.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1023072667 A -> C LOC_Os10g42760.1 upstream_gene_variant ; 984.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1023072667 A -> C LOC_Os10g42770.1 downstream_gene_variant ; 1389.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1023072667 A -> C LOC_Os10g42780.1 downstream_gene_variant ; 2729.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1023072667 A -> C LOC_Os10g42780.2 downstream_gene_variant ; 2729.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1023072667 A -> C LOC_Os10g42780.6 downstream_gene_variant ; 2729.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1023072667 A -> C LOC_Os10g42780.3 downstream_gene_variant ; 2729.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1023072667 A -> C LOC_Os10g42780.5 downstream_gene_variant ; 2729.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1023072667 A -> C LOC_Os10g42760-LOC_Os10g42770 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1023072667 A -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1023072667 A C -0.03 -0.04 -0.06 -0.02 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1023072667 NA 1.15E-11 mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 NA 4.44E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 NA 7.01E-21 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 NA 4.54E-09 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 NA 5.05E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 NA 2.40E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 NA 9.03E-08 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 NA 7.56E-11 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 NA 1.07E-09 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 NA 8.53E-12 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 NA 2.54E-11 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 NA 3.99E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 NA 1.88E-07 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 NA 8.01E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 2.29E-06 7.51E-14 mr1680_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 NA 4.53E-09 mr1680_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 NA 1.49E-14 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 NA 6.47E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 2.71E-06 6.24E-23 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023072667 NA 4.41E-11 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251