\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1022908675:

Variant ID: vg1022908675 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 22908675
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


ATCAATAACACACTCGGCGGAATTATCCCCGGACAGGAGTAGGGTATTACTTCTTTAATAAGAAAGCATGAACCTGTATAAAATTCCTTGTCTCTAAACC[C/T]
ATCCACTTTCCTAGCTTGATAGCCACCCCTTTTATTATTGCCGAAATCTTGTTTCGACAGTGAACTAAACAGGCCCTTAATCGTTCTCCTTTGTCATTCT

Reverse complement sequence

AGAATGACAAAGGAGAACGATTAAGGGCCTGTTTAGTTCACTGTCGAAACAAGATTTCGGCAATAATAAAAGGGGTGGCTATCAAGCTAGGAAAGTGGAT[G/A]
GGTTTAGAGACAAGGAATTTTATACAGGTTCATGCTTTCTTATTAAAGAAGTAATACCCTACTCCTGTCCGGGGATAATTCCGCCGAGTGTGTTATTGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 43.20% 0.13% 0.00% NA
All Indica  2759 87.20% 12.60% 0.18% 0.00% NA
All Japonica  1512 0.90% 99.10% 0.07% 0.00% NA
Aus  269 77.70% 22.30% 0.00% 0.00% NA
Indica I  595 67.10% 32.80% 0.17% 0.00% NA
Indica II  465 94.80% 4.90% 0.22% 0.00% NA
Indica III  913 95.10% 4.90% 0.00% 0.00% NA
Indica Intermediate  786 88.90% 10.70% 0.38% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.60% 0.20% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 41.10% 58.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1022908675 C -> T LOC_Os10g42480.1 upstream_gene_variant ; 4753.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022908675 C -> T LOC_Os10g42490.1 downstream_gene_variant ; 1785.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022908675 C -> T LOC_Os10g42490.2 downstream_gene_variant ; 1785.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022908675 C -> T LOC_Os10g42480-LOC_Os10g42490 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1022908675 C T 0.01 0.0 0.0 0.03 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1022908675 NA 2.16E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022908675 NA 6.39E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022908675 NA 1.56E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022908675 NA 4.28E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022908675 NA 2.10E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022908675 NA 1.77E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022908675 9.06E-06 NA mr1757 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022908675 NA 1.36E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251