\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1022847222:

Variant ID: vg1022847222 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 22847222
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATATGGGATTATATGATGGAAACCACAGATTACAAATGAAATAACAGAACTCGATGATACCGACGAGACCGTAGTCGAGTTGATTCGACTAGATCTCCC[A/G]
GCGACTCGGCTCCTGCGCGCTTCGTAAGCTGTGGTGGGTGTGTTGGCAGTGATATTCGATGCCTTAGGTCCTGCTCAGGGGGTCCCTCATATACCACGGG

Reverse complement sequence

CCCGTGGTATATGAGGGACCCCCTGAGCAGGACCTAAGGCATCGAATATCACTGCCAACACACCCACCACAGCTTACGAAGCGCGCAGGAGCCGAGTCGC[T/C]
GGGAGATCTAGTCGAATCAACTCGACTACGGTCTCGTCGGTATCATCGAGTTCTGTTATTTCATTTGTAATCTGTGGTTTCCATCATATAATCCCATATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.70% 9.30% 0.00% 0.00% NA
All Indica  2759 91.60% 8.40% 0.00% 0.00% NA
All Japonica  1512 86.60% 13.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 72.60% 27.40% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 96.60% 3.40% 0.00% 0.00% NA
Indica Intermediate  786 96.10% 3.90% 0.00% 0.00% NA
Temperate Japonica  767 91.80% 8.20% 0.00% 0.00% NA
Tropical Japonica  504 74.40% 25.60% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1022847222 A -> G LOC_Os10g42420-LOC_Os10g42430 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1022847222 A G 0.0 0.0 0.0 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1022847222 4.38E-06 4.38E-06 mr1214 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022847222 8.28E-06 8.28E-06 mr1306 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022847222 NA 1.48E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022847222 NA 2.69E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251