Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1022756524:

Variant ID: vg1022756524 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 22756524
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:

TTGCCGCTCATTGATATGCCATCATTTTCATTCGAAAGAAAGGGGAAGCTATGACAGCATATCCCCTAAATTATGCCGCCTGGACAAACAGTGGTGAATT[A/G]
GTTATGTATCTTGCAAAAATTATGGGCTTCCGGTGCCCAAAAAATGATGGCATGAATTGATTCAAGCTGCTTTGTTACCCAAAATAATCACATGTCTTTT

Reverse complement sequence

AAAAGACATGTGATTATTTTGGGTAACAAAGCAGCTTGAATCAATTCATGCCATCATTTTTTGGGCACCGGAAGCCCATAATTTTTGCAAGATACATAAC[T/C]
AATTCACCACTGTTTGTCCAGGCGGCATAATTTAGGGGATATGCTGTCATAGCTTCCCCTTTCTTTCGAATGAAAATGATGGCATATCAATGAGCGGCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.60%	24.20%	0.19%	0.00%	NA
All Indica	2759	97.00%	3.00%	0.07%	0.00%	NA
All Japonica	1512	37.00%	62.70%	0.26%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	96.00%	4.00%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	97.90%	2.10%	0.00%	0.00%	NA
Indica Intermediate	786	96.40%	3.30%	0.25%	0.00%	NA
Temperate Japonica	767	37.40%	62.10%	0.52%	0.00%	NA
Tropical Japonica	504	27.60%	72.40%	0.00%	0.00%	NA
Japonica Intermediate	241	55.60%	44.40%	0.00%	0.00%	NA
VI/Aromatic	96	17.70%	80.20%	2.08%	0.00%	NA
Intermediate	90	58.90%	40.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1022756524	A -> G	LOC_Os10g42250.1	3_prime_UTR_variant ; 186.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1022756524	A -> G	LOC_Os10g42250.2	3_prime_UTR_variant ; 186.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1022756524	A -> G	LOC_Os10g42240.1	downstream_gene_variant ; 3419.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1022756524	A -> G	LOC_Os10g42260.1	downstream_gene_variant ; 786.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1022756524	A -> G	LOC_Os10g42270.1	downstream_gene_variant ; 2628.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1022756524	A -> G	LOC_Os10g42240.2	downstream_gene_variant ; 3419.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1022756524	NA	2.74E-06	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022756524	NA	1.11E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022756524	NA	1.26E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022756524	2.85E-06	4.66E-06	mr1060_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022756524	NA	2.61E-06	mr1060_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022756524	NA	8.94E-06	mr1296_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022756524	NA	3.51E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022756524	NA	1.80E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022756524	NA	4.20E-06	mr1332_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022756524	NA	7.95E-10	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022756524	1.23E-06	NA	mr1546_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022756524	NA	3.93E-12	mr1553_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022756524	NA	8.25E-17	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022756524	NA	2.73E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022756524	NA	1.41E-12	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022756524	NA	3.56E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022756524	NA	3.56E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251