Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1022640788:

Variant ID: vg1022640788 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 22640788
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


CCCGCCCGGTCAGCGCCCGACGCCCACTGACAGGTGGGCCCACCCACAACTGGTTCCTGCCAGTGCCAGGCAGGCGTGGGCTTTGTGCCACTACTACTAC[C/T]
GTCTCCGCCTCCCATGAGGCGGGCGGTGGAACCGAGGAAACGCATCGCGTACGTGGCAGGCGGTGGGCCCCACCTGCAGGGTCTCCCTCCCCTCATCCCG

Reverse complement sequence

CGGGATGAGGGGAGGGAGACCCTGCAGGTGGGGCCCACCGCCTGCCACGTACGCGATGCGTTTCCTCGGTTCCACCGCCCGCCTCATGGGAGGCGGAGAC[G/A]
GTAGTAGTAGTGGCACAAAGCCCACGCCTGCCTGGCACTGGCAGGAACCAGTTGTGGGTGGGCCCACCTGTCAGTGGGCGTCGGGCGCTGACCGGGCGGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.30% 20.20% 0.51% 0.00% NA
All Indica  2759 97.20% 2.50% 0.25% 0.00% NA
All Japonica  1512 50.20% 48.80% 0.99% 0.00% NA
Aus  269 84.80% 15.20% 0.00% 0.00% NA
Indica I  595 95.30% 4.20% 0.50% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 99.70% 0.20% 0.11% 0.00% NA
Indica Intermediate  786 95.80% 3.80% 0.38% 0.00% NA
Temperate Japonica  767 46.70% 51.80% 1.56% 0.00% NA
Tropical Japonica  504 46.60% 53.20% 0.20% 0.00% NA
Japonica Intermediate  241 68.90% 30.30% 0.83% 0.00% NA
VI/Aromatic  96 22.90% 76.00% 1.04% 0.00% NA
Intermediate  90 62.20% 36.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1022640788 C -> T LOC_Os10g42080.1 upstream_gene_variant ; 4986.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022640788 C -> T LOC_Os10g42100.1 upstream_gene_variant ; 135.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022640788 C -> T LOC_Os10g42090.1 downstream_gene_variant ; 682.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022640788 C -> T LOC_Os10g42090.2 downstream_gene_variant ; 682.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022640788 C -> T LOC_Os10g42090-LOC_Os10g42100 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1022640788 C T -0.03 -0.04 -0.03 0.0 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1022640788 NA 2.50E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022640788 NA 1.74E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022640788 NA 5.78E-07 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022640788 1.18E-06 1.23E-07 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022640788 NA 3.37E-07 mr1060_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022640788 NA 2.58E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022640788 NA 8.44E-07 mr1296_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022640788 1.19E-06 1.19E-06 mr1355_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022640788 NA 2.31E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022640788 NA 3.01E-06 mr1358_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022640788 9.09E-06 1.55E-06 mr1546_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022640788 NA 6.07E-06 mr1707_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022640788 NA 3.90E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251