\
| Variant ID: vg1022634833 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 22634833 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CGTGTTGGAAATTTTTTGCATTACGCTCCTTCCAAATCAACCAACAAATTAGCATGAATGCACTGTCAAAATCCGTCCTATAGCTCGTCCGGAAACAACG[T/G]
CTTGTTGCCAGCCACCTGACGCCAGCGAGCCCGCCGTAATTCCATTGCGCGTACAAGATCTAGATTAACAGCTGACCAAACAAAGAGCATGCATGGTAAT
ATTACCATGCATGCTCTTTGTTTGGTCAGCTGTTAATCTAGATCTTGTACGCGCAATGGAATTACGGCGGGCTCGCTGGCGTCAGGTGGCTGGCAACAAG[A/C]
CGTTGTTTCCGGACGAGCTATAGGACGGATTTTGACAGTGCATTCATGCTAATTTGTTGGTTGATTTGGAAGGAGCGTAATGCAAAAAATTTCCAACACG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.60% | 3.50% | 1.93% | 0.00% | NA |
| All Indica | 2759 | 90.80% | 5.90% | 3.30% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 70.80% | 16.60% | 12.61% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.20% | 0.43% | 0.00% | NA |
| Indica III | 913 | 95.90% | 3.60% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 95.00% | 3.70% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1022634833 | T -> G | LOC_Os10g42066.1 | upstream_gene_variant ; 3556.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1022634833 | T -> G | LOC_Os10g42072.1 | upstream_gene_variant ; 1995.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1022634833 | T -> G | LOC_Os10g42090.1 | upstream_gene_variant ; 1252.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1022634833 | T -> G | LOC_Os10g42090.2 | upstream_gene_variant ; 1252.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1022634833 | T -> G | LOC_Os10g42080.1 | downstream_gene_variant ; 151.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1022634833 | T -> G | LOC_Os10g42072-LOC_Os10g42080 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1022634833 | 6.77E-06 | 6.77E-06 | mr1258 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022634833 | NA | 1.34E-06 | mr1306 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022634833 | NA | 7.74E-06 | mr1382 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022634833 | NA | 9.57E-06 | mr1550 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022634833 | NA | 9.02E-06 | mr1696 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022634833 | NA | 8.77E-06 | mr1740 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022634833 | NA | 1.85E-06 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022634833 | NA | 5.81E-06 | mr1611_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |