\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1022634833:

Variant ID: vg1022634833 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 22634833
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTGTTGGAAATTTTTTGCATTACGCTCCTTCCAAATCAACCAACAAATTAGCATGAATGCACTGTCAAAATCCGTCCTATAGCTCGTCCGGAAACAACG[T/G]
CTTGTTGCCAGCCACCTGACGCCAGCGAGCCCGCCGTAATTCCATTGCGCGTACAAGATCTAGATTAACAGCTGACCAAACAAAGAGCATGCATGGTAAT

Reverse complement sequence

ATTACCATGCATGCTCTTTGTTTGGTCAGCTGTTAATCTAGATCTTGTACGCGCAATGGAATTACGGCGGGCTCGCTGGCGTCAGGTGGCTGGCAACAAG[A/C]
CGTTGTTTCCGGACGAGCTATAGGACGGATTTTGACAGTGCATTCATGCTAATTTGTTGGTTGATTTGGAAGGAGCGTAATGCAAAAAATTTCCAACACG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.60% 3.50% 1.93% 0.00% NA
All Indica  2759 90.80% 5.90% 3.30% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 70.80% 16.60% 12.61% 0.00% NA
Indica II  465 99.40% 0.20% 0.43% 0.00% NA
Indica III  913 95.90% 3.60% 0.44% 0.00% NA
Indica Intermediate  786 95.00% 3.70% 1.27% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1022634833 T -> G LOC_Os10g42066.1 upstream_gene_variant ; 3556.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022634833 T -> G LOC_Os10g42072.1 upstream_gene_variant ; 1995.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022634833 T -> G LOC_Os10g42090.1 upstream_gene_variant ; 1252.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022634833 T -> G LOC_Os10g42090.2 upstream_gene_variant ; 1252.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022634833 T -> G LOC_Os10g42080.1 downstream_gene_variant ; 151.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022634833 T -> G LOC_Os10g42072-LOC_Os10g42080 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1022634833 6.77E-06 6.77E-06 mr1258 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022634833 NA 1.34E-06 mr1306 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022634833 NA 7.74E-06 mr1382 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022634833 NA 9.57E-06 mr1550 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022634833 NA 9.02E-06 mr1696 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022634833 NA 8.77E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022634833 NA 1.85E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022634833 NA 5.81E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251