\
| Variant ID: vg1022609740 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 22609740 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATATGCCGACGAGAGGGGTCCCAGACCAACAACAGGTTAGGTCCCAGACCATACTGTGCCAGGAAGCCCAGGGGTCCTCCCCGACACCACCCCGGCGAAT[T/C]
CACATGTCTCTCGGCATCAAGGCTCCCCTGATAAGCTAGTTACTCAGCTAGGGGTGTCCCATTCCACCCATGTGGTCGTACTTGTCTTATGTTTAGATGA
TCATCTAAACATAAGACAAGTACGACCACATGGGTGGAATGGGACACCCCTAGCTGAGTAACTAGCTTATCAGGGGAGCCTTGATGCCGAGAGACATGTG[A/G]
ATTCGCCGGGGTGGTGTCGGGGAGGACCCCTGGGCTTCCTGGCACAGTATGGTCTGGGACCTAACCTGTTGTTGGTCTGGGACCCCTCTCGTCGGCATAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 19.10% | 16.90% | 3.17% | 60.85% | NA |
| All Indica | 2759 | 3.80% | 0.10% | 2.79% | 93.22% | NA |
| All Japonica | 1512 | 43.70% | 51.50% | 3.77% | 1.06% | NA |
| Aus | 269 | 9.70% | 0.00% | 2.60% | 87.73% | NA |
| Indica I | 595 | 4.50% | 0.00% | 1.68% | 93.78% | NA |
| Indica II | 465 | 3.20% | 0.60% | 1.94% | 94.19% | NA |
| Indica III | 913 | 2.00% | 0.10% | 3.40% | 94.52% | NA |
| Indica Intermediate | 786 | 5.90% | 0.00% | 3.44% | 90.71% | NA |
| Temperate Japonica | 767 | 49.50% | 48.90% | 0.52% | 1.04% | NA |
| Tropical Japonica | 504 | 42.90% | 45.40% | 10.32% | 1.39% | NA |
| Japonica Intermediate | 241 | 26.60% | 72.60% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 79.20% | 7.30% | 3.12% | 10.42% | NA |
| Intermediate | 90 | 37.80% | 8.90% | 6.67% | 46.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1022609740 | T -> C | LOC_Os10g42050.1 | upstream_gene_variant ; 4607.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1022609740 | T -> C | LOC_Os10g42040.1 | downstream_gene_variant ; 1038.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1022609740 | T -> C | LOC_Os10g42040-LOC_Os10g42050 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1022609740 | T -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1022609740 | NA | 8.28E-12 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1022609740 | NA | 5.05E-06 | mr1293 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022609740 | NA | 5.53E-06 | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022609740 | NA | 1.39E-06 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022609740 | NA | 3.18E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022609740 | NA | 4.33E-06 | mr1507 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022609740 | NA | 1.22E-07 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022609740 | NA | 1.42E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022609740 | NA | 2.62E-07 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022609740 | NA | 1.36E-10 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022609740 | NA | 2.09E-06 | mr1060_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022609740 | NA | 8.74E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022609740 | NA | 7.07E-06 | mr1296_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022609740 | 7.23E-07 | 7.23E-07 | mr1360_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |