Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1022579187:

Variant ID: vg1022579187 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 22579187
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


ATACATATATATGCTGGATATATTTATGCAGGGAGAGGTGTGTCCGTGGGATATCCAGGTCCTCGTTCCAACAAGGCCAGCAGTTACTCCAGGGGCGGCG[T/G]
GGGATGCAGCAGTATCGACGAGTGCGACGCCCCTCCAGCTCCAGGTGAAGAAGTCTTACCATGACAGTCTGCTCTCCAAGAGTCTGTTTGACGCCATTTT

Reverse complement sequence

AAAATGGCGTCAAACAGACTCTTGGAGAGCAGACTGTCATGGTAAGACTTCTTCACCTGGAGCTGGAGGGGCGTCGCACTCGTCGATACTGCTGCATCCC[A/C]
CGCCGCCCCTGGAGTAACTGCTGGCCTTGTTGGAACGAGGACCTGGATATCCCACGGACACACCTCTCCCTGCATAAATATATCCAGCATATATATGTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.70% 17.70% 0.34% 48.24% NA
All Indica  2759 17.50% 2.80% 0.58% 79.12% NA
All Japonica  1512 57.40% 42.10% 0.00% 0.53% NA
Aus  269 71.40% 7.10% 0.00% 21.56% NA
Indica I  595 3.50% 4.20% 0.50% 91.76% NA
Indica II  465 26.50% 2.40% 1.08% 70.11% NA
Indica III  913 19.30% 0.90% 0.33% 79.52% NA
Indica Intermediate  786 20.90% 4.10% 0.64% 74.43% NA
Temperate Japonica  767 51.00% 48.40% 0.00% 0.65% NA
Tropical Japonica  504 58.70% 40.70% 0.00% 0.60% NA
Japonica Intermediate  241 75.10% 24.90% 0.00% 0.00% NA
VI/Aromatic  96 19.80% 78.10% 0.00% 2.08% NA
Intermediate  90 34.40% 33.30% 0.00% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1022579187 T -> G LOC_Os10g41999.1 missense_variant ; p.Val56Gly; MODERATE nonsynonymous_codon ; V56G Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 unknown unknown TOLERATED 0.67
vg1022579187 T -> DEL LOC_Os10g41999.1 N frameshift_variant Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1022579187 T G 0.0 0.01 0.02 -0.04 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1022579187 NA 7.00E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022579187 1.37E-08 5.05E-10 mr1060_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022579187 NA 5.87E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022579187 NA 3.61E-07 mr1060_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022579187 NA 8.23E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022579187 NA 2.21E-07 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022579187 NA 1.17E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022579187 NA 2.72E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022579187 NA 6.70E-06 mr1371_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022579187 NA 2.57E-10 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022579187 NA 9.75E-06 mr1748_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022579187 NA 3.87E-10 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022579187 NA 3.87E-10 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022579187 NA 9.54E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251