Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1022578618:

Variant ID: vg1022578618 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 22578618
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCAAATTGGCCGTGGAAGGAGGAGCTACGCCGCCGCGCGCACAATTTCTTTCTAAAAAAAAGTTTGAATGCACTTTTCTTTCTCAAAATCTCGTTTTC[C/T]
AAAATAAAACTATTTCTTCATATGTTTCATTCTCTTAACTAATCACAATCATTTTCTATTTTGATTTCATCATCTACTATCTTTTCTCAATTAATCATAA

Reverse complement sequence

TTATGATTAATTGAGAAAAGATAGTAGATGATGAAATCAAAATAGAAAATGATTGTGATTAGTTAAGAGAATGAAACATATGAAGAAATAGTTTTATTTT[G/A]
GAAAACGAGATTTTGAGAAAGAAAAGTGCATTCAAACTTTTTTTTAGAAAGAAATTGTGCGCGCGGCGGCGTAGCTCCTCCTTCCACGGCCAATTTGGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.50% 7.70% 1.57% 47.23% NA
All Indica  2759 20.50% 0.30% 1.78% 77.46% NA
All Japonica  1512 74.90% 23.10% 1.59% 0.46% NA
Aus  269 78.40% 0.00% 0.00% 21.56% NA
Indica I  595 8.20% 0.20% 3.03% 88.57% NA
Indica II  465 28.20% 0.60% 1.51% 69.68% NA
Indica III  913 20.30% 0.30% 1.31% 78.09% NA
Indica Intermediate  786 25.60% 0.00% 1.53% 72.90% NA
Temperate Japonica  767 89.80% 7.40% 2.22% 0.52% NA
Tropical Japonica  504 57.10% 41.90% 0.40% 0.60% NA
Japonica Intermediate  241 64.30% 33.60% 2.07% 0.00% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 61.10% 6.70% 1.11% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1022578618 C -> T LOC_Os10g41999.1 upstream_gene_variant ; 284.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022578618 C -> T LOC_Os10g41980.1 downstream_gene_variant ; 2087.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022578618 C -> T LOC_Os10g41980-LOC_Os10g41999 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022578618 C -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1022578618 NA 7.14E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1022578618 NA 8.14E-06 mr1177 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578618 NA 5.81E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578618 NA 2.79E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578618 6.02E-06 6.02E-06 mr1418 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578618 NA 1.04E-06 mr1492 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578618 NA 5.82E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578618 1.55E-06 1.55E-06 mr1833 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578618 NA 1.35E-06 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578618 NA 3.88E-09 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578618 NA 3.90E-07 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578618 NA 3.81E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251