\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1022548815:

Variant ID: vg1022548815 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 22548815
Reference Allele: CCGGCAAlternative Allele: C,TCGGCA
Primary Allele: CSecondary Allele: CCGGCA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCCAATCGTCGATTCCATCCAGGAGTTTCTTCATCTTGCCAGCATCGTCGTGGTTGAGTTGTTTGTTGGCTTCGGAGTATAGATGGCCATGTGGGCCGC[CCGGCA/C,TCGGCA]
CGGCACGGCCCAGGTCCGGCCGTGCCTGGTCCGAGGCTTGTCGGGCCGGCACGGCCCGACCGACGCACCGGGCCGTGCCGTGCCAGCCCACGTGCCGCAC

Reverse complement sequence

GTGCGGCACGTGGGCTGGCACGGCACGGCCCGGTGCGTCGGTCGGGCCGTGCCGGCCCGACAAGCCTCGGACCAGGCACGGCCGGACCTGGGCCGTGCCG[TGCCGG/G,TGCCGA]
GCGGCCCACATGGCCATCTATACTCCGAAGCCAACAAACAACTCAACCACGACGATGCTGGCAAGATGAAGAAACTCCTGGATGGAATCGACGATTGGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of CCGGCA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 34.60% 6.69% 1.65% TCGGCA: 6.41%
All Indica  2759 81.80% 2.70% 10.55% 2.79% TCGGCA: 2.21%
All Japonica  1512 3.10% 93.80% 0.60% 0.00% TCGGCA: 2.45%
Aus  269 21.20% 7.80% 1.86% 0.37% TCGGCA: 68.77%
Indica I  595 79.30% 4.00% 13.78% 2.02% TCGGCA: 0.84%
Indica II  465 74.80% 2.80% 16.13% 5.38% TCGGCA: 0.86%
Indica III  913 89.20% 1.00% 5.04% 1.64% TCGGCA: 3.18%
Indica Intermediate  786 79.10% 3.60% 11.20% 3.18% TCGGCA: 2.93%
Temperate Japonica  767 0.40% 97.90% 0.52% 0.00% TCGGCA: 1.17%
Tropical Japonica  504 8.10% 88.90% 0.60% 0.00% TCGGCA: 2.38%
Japonica Intermediate  241 1.20% 91.30% 0.83% 0.00% TCGGCA: 6.64%
VI/Aromatic  96 4.20% 83.30% 1.04% 0.00% TCGGCA: 11.46%
Intermediate  90 33.30% 45.60% 11.11% 0.00% TCGGCA: 10.00%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1022548815 CCGGCA -> C LOC_Os10g41900.1 upstream_gene_variant ; 67.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022548815 CCGGCA -> C LOC_Os10g41910.1 upstream_gene_variant ; 337.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022548815 CCGGCA -> C LOC_Os10g41920.1 downstream_gene_variant ; 3551.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022548815 CCGGCA -> C LOC_Os10g41900-LOC_Os10g41910 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022548815 CCGGCA -> TCGGCA LOC_Os10g41900.1 upstream_gene_variant ; 66.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022548815 CCGGCA -> TCGGCA LOC_Os10g41910.1 upstream_gene_variant ; 338.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022548815 CCGGCA -> TCGGCA LOC_Os10g41920.1 downstream_gene_variant ; 3552.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022548815 CCGGCA -> TCGGCA LOC_Os10g41900-LOC_Os10g41910 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022548815 CCGGCA -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1022548815 CCGGC* C -0.08 -0.03 -0.03 -0.01 -0.06 -0.04
vg1022548815 CCGGC* TCGGC* 0.12 0.14 0.12 0.1 0.11 0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1022548815 4.33E-06 NA mr1793_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251