Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1022537974:

Variant ID: vg1022537974 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 22537974
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

TATAGTATTGTAATTTATATTTCACGACGACGAGAGGGACGGTGTCGCTCGCCGAATAGCGTTGGCCGTACTGCCGGCGGCCGGCTCGCCGGTCAGAGGC[C/T]
ACCTTGCCACCGTGTTTCTCTATCATGGTGCACGCATGGGCTAGCTGACACAGGCCGTGAGCTGCAGCTCACATCACAAGTGGTGCATAGCGTGCGGCCA

Reverse complement sequence

TGGCCGCACGCTATGCACCACTTGTGATGTGAGCTGCAGCTCACGGCCTGTGTCAGCTAGCCCATGCGTGCACCATGATAGAGAAACACGGTGGCAAGGT[G/A]
GCCTCTGACCGGCGAGCCGGCCGCCGGCAGTACGGCCAACGCTATTCGGCGAGCGACACCGTCCCTCTCGTCGTCGTGAAATATAAATTACAATACTATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.80%	36.80%	1.86%	2.54%	NA
All Indica	2759	31.60%	61.10%	3.01%	4.28%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	94.10%	5.20%	0.37%	0.37%	NA
Indica I	595	17.10%	71.90%	5.55%	5.38%	NA
Indica II	465	31.40%	63.00%	2.37%	3.23%	NA
Indica III	913	34.90%	57.50%	1.64%	5.91%	NA
Indica Intermediate	786	38.70%	56.10%	3.05%	2.16%	NA
Temperate Japonica	767	99.30%	0.70%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	63.30%	31.10%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1022537974	C -> T	LOC_Os10g41870.1	upstream_gene_variant ; 4684.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1022537974	C -> T	LOC_Os10g41880.1	upstream_gene_variant ; 3265.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1022537974	C -> T	LOC_Os10g41870.2	upstream_gene_variant ; 3595.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1022537974	C -> T	LOC_Os10g41870-LOC_Os10g41880	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1022537974	C -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1022537974	NA	6.38E-10	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022537974	1.85E-06	1.07E-06	mr1725	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022537974	NA	1.96E-06	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022537974	NA	2.09E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022537974	NA	3.55E-06	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022537974	NA	1.19E-09	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022537974	NA	2.00E-06	mr1341_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022537974	NA	3.54E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251