\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1022397720:

Variant ID: vg1022397720 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 22397720
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGAGTTGAAAGTTTTTAAATTTTAAGTTGAAAGTTTTATAATTTGACTTGAAAGTTTTCAAATCTGAGTTGAAAGTTTTAAATTTGAGTTGAAAGTTTT[C/T]
AAATCTGAGTTGAAAGTTTTAAATTCGAGTTGAAAGTTTTCAAATCTAAGTTAAAAATTTTAAATTCGAGTTGAAAGTTTTTGAAATTCCGGTCAAAAGA

Reverse complement sequence

TCTTTTGACCGGAATTTCAAAAACTTTCAACTCGAATTTAAAATTTTTAACTTAGATTTGAAAACTTTCAACTCGAATTTAAAACTTTCAACTCAGATTT[G/A]
AAAACTTTCAACTCAAATTTAAAACTTTCAACTCAGATTTGAAAACTTTCAAGTCAAATTATAAAACTTTCAACTTAAAATTTAAAAACTTTCAACTCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.00% 2.80% 1.21% 0.00% NA
All Indica  2759 99.90% 0.00% 0.07% 0.00% NA
All Japonica  1512 87.80% 8.80% 3.37% 0.00% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.00% 0.25% 0.00% NA
Temperate Japonica  767 81.70% 12.60% 5.61% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 82.60% 14.10% 3.32% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1022397720 C -> T LOC_Os10g41590.1 downstream_gene_variant ; 1842.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022397720 C -> T LOC_Os10g41590.2 downstream_gene_variant ; 2377.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022397720 C -> T LOC_Os10g41590-LOC_Os10g41610 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1022397720 3.52E-06 4.43E-08 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022397720 3.63E-07 2.26E-08 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022397720 8.71E-07 1.21E-09 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022397720 4.37E-08 2.03E-09 mr1586 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022397720 NA 3.09E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022397720 5.32E-06 6.66E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022397720 NA 1.78E-08 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022397720 NA 1.45E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251