Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1022397720:

Variant ID: vg1022397720 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 22397720
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGAGTTGAAAGTTTTTAAATTTTAAGTTGAAAGTTTTATAATTTGACTTGAAAGTTTTCAAATCTGAGTTGAAAGTTTTAAATTTGAGTTGAAAGTTTT[C/T]
AAATCTGAGTTGAAAGTTTTAAATTCGAGTTGAAAGTTTTCAAATCTAAGTTAAAAATTTTAAATTCGAGTTGAAAGTTTTTGAAATTCCGGTCAAAAGA

Reverse complement sequence

TCTTTTGACCGGAATTTCAAAAACTTTCAACTCGAATTTAAAATTTTTAACTTAGATTTGAAAACTTTCAACTCGAATTTAAAACTTTCAACTCAGATTT[G/A]
AAAACTTTCAACTCAAATTTAAAACTTTCAACTCAGATTTGAAAACTTTCAAGTCAAATTATAAAACTTTCAACTTAAAATTTAAAAACTTTCAACTCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.00%	2.80%	1.21%	0.00%	NA
All Indica	2759	99.90%	0.00%	0.07%	0.00%	NA
All Japonica	1512	87.80%	8.80%	3.37%	0.00%	NA
Aus	269	99.30%	0.00%	0.74%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.00%	0.25%	0.00%	NA
Temperate Japonica	767	81.70%	12.60%	5.61%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	82.60%	14.10%	3.32%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	0.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1022397720	C -> T	LOC_Os10g41590.1	downstream_gene_variant ; 1842.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1022397720	C -> T	LOC_Os10g41590.2	downstream_gene_variant ; 2377.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1022397720	C -> T	LOC_Os10g41590-LOC_Os10g41610	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1022397720	3.52E-06	4.43E-08	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022397720	3.63E-07	2.26E-08	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022397720	8.71E-07	1.21E-09	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022397720	4.37E-08	2.03E-09	mr1586	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022397720	NA	3.09E-06	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022397720	5.32E-06	6.66E-08	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022397720	NA	1.78E-08	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022397720	NA	1.45E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251