\
| Variant ID: vg1021824431 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 21824431 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )
GAACCGGGGTCAATACTGCCTAAGCACCTATAATGATCCGGTTATATAAGTTTAGGGATGCCATATATCTGATTTTCGGTTCAAAGACGATTTTTTAACT[T/C]
CGTGACAAGATGGGAGATCTTAGGTGAACTTTTTTCCTTTGCGAATACATCAATGTTTGCTAGCCTCTCCTCCCTATTGTGTTGGTTCATTTTGCAATGG
CCATTGCAAAATGAACCAACACAATAGGGAGGAGAGGCTAGCAAACATTGATGTATTCGCAAAGGAAAAAAGTTCACCTAAGATCTCCCATCTTGTCACG[A/G]
AGTTAAAAAATCGTCTTTGAACCGAAAATCAGATATATGGCATCCCTAAACTTATATAACCGGATCATTATAGGTGCTTAGGCAGTATTGACCCCGGTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.40% | 9.60% | 1.04% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 68.10% | 28.70% | 3.17% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 45.80% | 49.50% | 4.69% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 4.40% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.60% | 13.30% | 4.15% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1021824431 | T -> C | LOC_Os10g40680.1 | downstream_gene_variant ; 731.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1021824431 | T -> C | LOC_Os10g40680-LOC_Os10g40700 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1021824431 | NA | 3.65E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021824431 | NA | 3.21E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021824431 | 2.60E-06 | NA | mr1518 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021824431 | NA | 5.71E-08 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021824431 | NA | 6.88E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021824431 | NA | 6.64E-06 | mr1786 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021824431 | NA | 2.81E-06 | mr1955 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |