\
| Variant ID: vg1021305364 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 21305364 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 286. )
AAACTGTAGTTGTAGAATACAGAAAATAAACTAGAAGTCAGAAGCTGGGTTTCCCAGCTTCTCCAAATTCTCACCAGTTGTTTCTTAGAATCTTAAACTC[C/T]
ACCAAACAGGGCCAAGGACGATAACTATCCTTGGATTTATAGATGTGTTTTTGGTGTGTTTTACTGTACCTGCCGGAAAAAGAAACTATCCTCTGTTCGT
ACGAACAGAGGATAGTTTCTTTTTCCGGCAGGTACAGTAAAACACACCAAAAACACATCTATAAATCCAAGGATAGTTATCGTCCTTGGCCCTGTTTGGT[G/A]
GAGTTTAAGATTCTAAGAAACAACTGGTGAGAATTTGGAGAAGCTGGGAAACCCAGCTTCTGACTTCTAGTTTATTTTCTGTATTCTACAACTACAGTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.00% | 3.80% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 93.50% | 6.30% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.80% | 5.90% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1021305364 | C -> T | LOC_Os10g39790.2 | upstream_gene_variant ; 3636.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1021305364 | C -> T | LOC_Os10g39810.1 | upstream_gene_variant ; 3089.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1021305364 | C -> T | LOC_Os10g39790.3 | upstream_gene_variant ; 3636.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1021305364 | C -> T | LOC_Os10g39790.4 | upstream_gene_variant ; 3636.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1021305364 | C -> T | LOC_Os10g39810.2 | upstream_gene_variant ; 3089.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1021305364 | C -> T | LOC_Os10g39800.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1021305364 | NA | 1.26E-06 | mr1343 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021305364 | 4.19E-06 | 6.27E-07 | mr1392 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021305364 | 8.88E-06 | 8.88E-06 | mr1392 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021305364 | NA | 3.10E-06 | mr1415 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021305364 | NA | 3.10E-06 | mr1567 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021305364 | NA | 1.88E-09 | mr1902_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |