Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1021219935:

Variant ID: vg1021219935 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 21219935
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

AGCGCCGAGCTCATCCGGCGGGAGCTCGCCGCCTTCTTCGGCCAGACCTCCCACGAGACCACCGGTACATTATTAATTACAGTGTGCAGATTAATCTTAC[A/C]
GCCATTTTTTTACCATCTTGATCTGAGTATTAACCGTGGTAAATTAATTCAGATGGAACGAGGGGTAGTTCTGACCAGTTCCAGTGGGGTTACTGCTTCA

Reverse complement sequence

TGAAGCAGTAACCCCACTGGAACTGGTCAGAACTACCCCTCGTTCCATCTGAATTAATTTACCACGGTTAATACTCAGATCAAGATGGTAAAAAAATGGC[T/G]
GTAAGATTAATCTGCACACTGTAATTAATAATGTACCGGTGGTCTCGTGGGAGGTCTGGCCGAAGAAGGCGGCGAGCTCCCGCCGGATGAGCTCGGCGCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.40%	16.00%	0.23%	57.32%	NA
All Indica	2759	2.50%	2.00%	0.25%	95.29%	NA
All Japonica	1512	69.90%	28.90%	0.00%	1.19%	NA
Aus	269	0.00%	90.30%	0.74%	8.92%	NA
Indica I	595	3.70%	0.20%	0.34%	95.80%	NA
Indica II	465	2.40%	1.70%	0.00%	95.91%	NA
Indica III	913	1.50%	1.60%	0.33%	96.50%	NA
Indica Intermediate	786	2.80%	3.80%	0.25%	93.13%	NA
Temperate Japonica	767	47.70%	50.70%	0.00%	1.56%	NA
Tropical Japonica	504	98.20%	1.20%	0.00%	0.60%	NA
Japonica Intermediate	241	81.30%	17.40%	0.00%	1.24%	NA
VI/Aromatic	96	89.60%	8.30%	0.00%	2.08%	NA
Intermediate	90	40.00%	17.80%	2.22%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1021219935	A -> C	LOC_Os10g39710.1	upstream_gene_variant ; 4432.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1021219935	A -> C	LOC_Os10g39710.2	upstream_gene_variant ; 4432.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1021219935	A -> C	LOC_Os10g39700.1	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1021219935	A -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1021219935	NA	2.00E-17	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935	NA	4.58E-13	mr1322	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935	NA	1.00E-11	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935	NA	1.52E-13	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935	NA	5.75E-13	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935	NA	1.90E-11	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935	7.80E-06	4.19E-10	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935	NA	2.22E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935	NA	3.20E-13	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935	NA	1.34E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935	NA	1.20E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935	NA	1.68E-13	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935	5.50E-06	NA	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935	NA	1.28E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935	NA	4.54E-18	mr1336_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935	NA	3.32E-12	mr1553_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251