\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1021219935:

Variant ID: vg1021219935 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 21219935
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AGCGCCGAGCTCATCCGGCGGGAGCTCGCCGCCTTCTTCGGCCAGACCTCCCACGAGACCACCGGTACATTATTAATTACAGTGTGCAGATTAATCTTAC[A/C]
GCCATTTTTTTACCATCTTGATCTGAGTATTAACCGTGGTAAATTAATTCAGATGGAACGAGGGGTAGTTCTGACCAGTTCCAGTGGGGTTACTGCTTCA

Reverse complement sequence

TGAAGCAGTAACCCCACTGGAACTGGTCAGAACTACCCCTCGTTCCATCTGAATTAATTTACCACGGTTAATACTCAGATCAAGATGGTAAAAAAATGGC[T/G]
GTAAGATTAATCTGCACACTGTAATTAATAATGTACCGGTGGTCTCGTGGGAGGTCTGGCCGAAGAAGGCGGCGAGCTCCCGCCGGATGAGCTCGGCGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.40% 16.00% 0.23% 57.32% NA
All Indica  2759 2.50% 2.00% 0.25% 95.29% NA
All Japonica  1512 69.90% 28.90% 0.00% 1.19% NA
Aus  269 0.00% 90.30% 0.74% 8.92% NA
Indica I  595 3.70% 0.20% 0.34% 95.80% NA
Indica II  465 2.40% 1.70% 0.00% 95.91% NA
Indica III  913 1.50% 1.60% 0.33% 96.50% NA
Indica Intermediate  786 2.80% 3.80% 0.25% 93.13% NA
Temperate Japonica  767 47.70% 50.70% 0.00% 1.56% NA
Tropical Japonica  504 98.20% 1.20% 0.00% 0.60% NA
Japonica Intermediate  241 81.30% 17.40% 0.00% 1.24% NA
VI/Aromatic  96 89.60% 8.30% 0.00% 2.08% NA
Intermediate  90 40.00% 17.80% 2.22% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1021219935 A -> C LOC_Os10g39710.1 upstream_gene_variant ; 4432.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1021219935 A -> C LOC_Os10g39710.2 upstream_gene_variant ; 4432.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1021219935 A -> C LOC_Os10g39700.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1021219935 A -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1021219935 NA 2.00E-17 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935 NA 4.58E-13 mr1322 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935 NA 1.00E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935 NA 1.52E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935 NA 5.75E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935 NA 1.90E-11 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935 7.80E-06 4.19E-10 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935 NA 2.22E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935 NA 3.20E-13 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935 NA 1.34E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935 NA 1.20E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935 NA 1.68E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935 5.50E-06 NA mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935 NA 1.28E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935 NA 4.54E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021219935 NA 3.32E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251